Effects of AMPEP (Ascophyllum marine plant extract powder) and SJEP (enzymatic extracts of Saccharina japonica) on growth and resistance of red macroalga Pyropia yezoensis

Article information

Algae. 2025;40(3):269-284
Publication date (electronic) : 2025 September 15
doi : https://doi.org/10.4490/algae.2025.40.8.28
1MOE Key Laboratory of Marine Genetics and Breeding, College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China
2Faculty of Bioscience Engineering, Ghent University, Gent 9000, Beilguim
3Weifang Macroalga Biotech Co., Ltd., Weifang 261500, China
*Corresponding Author: E-mail: duguo923@ouc.edu.cn, Tel: +86-82031817
Received 2025 June 5; Accepted 2025 August 28.

Abstract

Seaweed extracts are widely used as biostimulants in terrestrial crops but remain underexplored for economic macroalgae. This study investigated the effects of Ascophyllum marine plant extract powder (AMPEP) and Saccharina japonica extract powder (SJEP) on the growth and stress resistance of Pyropia yezoensis, a commercially significant red macroalga along the Northeast Asia coast. Through gradient analysis, optimal concentrations were determined to be 0.05 g L−1 for SJEP and 0.1 g L−1 for AMPEP, based on their effects on daily growth rate (DGR) and photosynthetic performance. Both extracts significantly improved resistance to red rot disease, reducing lesion area while increasing DGR, photosynthetic efficiency, and pigment content compared to the control. Additionally, SJEP and AMPEP elevated superoxide dismutase (SOD) activity and suppressed malondialdehyde (MDA) accumulation. Under cold stress, the extracts mitigated declines in DGR, photosynthetic parameters, pigment levels, and SOD activity, while restraining MDA elevation. Notably, the expression of cold-responsive genes (PyABCC1 and PyABCI1) peaked in SJEP treatment and remained elevated in AMPEP treatment, surpassing the control by several-fold. Overall, SJEP outperformed AMPEP, likely due to its higher polysaccharide and polyphenols. These results support brown algal extracts—particularly enzymatic extracts—as practical biostimulants to enhance growth, disease resistance, and cold tolerance in P. yezoensis cultivation.

INTRODUCTION

Seaweed extracts, derived from macroalgae, are biostimulants that are environmentally friendly, non-toxic, and pollution-free, posing no harm to humans, animals, and ecosystems (Critchley et al. 2021). These extracts have been used in agriculture since 1950 to increase crop yield and quality, as well as stimulate defenses against abiotic and biotic stresses, including drought, temperature stress, and diseases. They function by promoting plant growth, enhancing stress resistance, and improving soil environment (Williams et al. 2015, Critchley et al. 2021, Shahrajabian et al. 2021). The efficacy of seaweed extracts is attributed to their rich content of physiologically active substances, mainly including polysaccharides, carotenoids, amino acids, proteins, lipids, and polyphenols (Ali et al. 2021). Notably, extracts from brown algae are particularly rich in active components such as fucoidan, which possess antioxidant, anti-inflammatory, and antiviral activities, significantly enhancing resistance to adverse conditions (Sulmon et al. 2006, Zou et al. 2019, Bouissil et al. 2020). Furthermore, polyphenols in seaweed extracts also exhibit multiple bioactivities, including antioxidant, antibacterial, antiviral, and matrix metalloproteinase activities, which can significantly improve plant stress resistance (Besednova et al. 2021, Zagoskina et al. 2023).

The primary application of seaweed extracts on economic macroalgae was conducted by Robertson-Anderson et al. (2006) in South Africa. Through a terrestrial pool experiment, they utilized commercial product of brown algae Ecklonia maxima extract on green algae Ulva pertusa and red algae Gracilaria vermiculophylla, but the result indicated no significant growth-promoting effect. Subsequently, the commercial product of Ascophyllum marine plant extract powder (AMPEP) was applied to red algae Kappaphycus, Gracilaria, and Eucheuma, brown algae Saccharina, and green algae Ulva (Ali et al. 2018, Hurtado and Critchley 2020). These studies demonstrated that AMPEP can enhance the efficiency of asexual spore propagation, reduce the impact of ice-ice disease, epiphytes and endophytes, and promote the growth of seaweed cultivated indoors and in the sea. It also improves tolerance to temperature stress, such as enabling tropical seaweed Kappaphycus to withstand lethal low temperatures (Loureiro et al. 2014), and temperate and cold seaweed Saccharina to tolerate high temperatures (Umanzor et al. 2019). Further studies were carried on brown algae extract Kelpak applying to brown algae Saccharina spp., which indicated an enhancement of resistance to high-temperature stress with higher survival rates and growth vitality (Umanzor et al. 2020). They also investigated the extract of brown algae Sargassum horneri on improvement of high-temperature tolerance in Neopyropia yezoensis and Palmaria hecatensis (Han et al. 2022, Xing et al. 2023, Jung et al. 2025). The studies have demonstrated the overall efficacy of seaweed extracts in seaweed cultivation, highlighting their potential as biostimulants that can enhance growth and mitigate the effects of biotic and abiotic stresses.

Pyropia yezoensis, a key economic seaweed, is predominantly cultivated along the coasts of China, Japan, and Korea in East Asia (Blouin et al. 2011). Alongside Porphyra haitanensis, which falls under the same Porphyra sensu lato species and is commonly referred to as nori, the combined annual production of these species can reach three million tons, with an estimated market value of $2.83 billion (Food and Agriculture Organization of the United Nations 2023). However, in recent years, climate change and anthropogenic disturbances in coastal regions have led to an increased frequency of physiological and pathological diseases, resulting in substantial economic losses (Tang et al. 2019, Zeb et al. 2024). Given that the cultivation period of P. yezoensis extends through the winter, low-temperature stress has emerged as a significant factor limiting its productivity by affecting the morphology, physiology, and biochemistry. Therefore, the application of seaweed extracts to enhance the growth and stress tolerance of P. yezoensis is crucial for the healthy and sustainable development of the nori industry.

This study aimed to first determine the optimal usage conditions of Saccharina japonica enzymatic extracts (SJEP) and commercial AMPEP, and to evaluate their effects on the growth and photosynthetic activity of P. yezoensis. Subsequently, the study investigated the further effects of these two extracts under Pythium porphyrae infection and low-temperature stress, respectively, in order to explore their potential to enhance the disease resistance and stress tolerance of P. yezoensis. The research is expected to provide a scientific foundation and theoretical framework for the rational application of seaweed extracts in the nori industry, promoting its sustainable development.

MATERIALS AND METHODS

Experiment materials

Pyropia yezoensis strain PY440 was provided by our laboratory of Algal Genetics and Breeding at Ocean University of China. The thalli were cultured under conditions of 0.02× PES (Provasoli’s enrichment solution) medium, 10°C, 50 μmol photons m−2 s−1, and a 12 L : 12 D photoperiod with aeration. P. yezoensis thalli reaching 3 cm in length were used for further experiments. Two tested commercial seaweed extracts are the extract of Ascophyllum nodosum (AMPEP) produced by Canadian Acadian Seaplants Ltd. (Cornwallis Park, Canada) and SJEP by Weifang Macroalga Biotech Co. Ltd. (Weifang, China), both are soluble powders. The pathogen P. porphyrae is strain NBRC33253 isolated by our laboratory.

Effects on growth and photosynthesis by different concentrations

The AMPEP and SJEP extracts were prepared at six different concentrations (0.0005, 0.001, 0.01, 0.05, 0.1, and 0.5 g L−1). The 0.02× PES culture medium without extract served as the control. The P. yezoensis thalli were soaked in the respective solutions for 30 min, with three replicates per treatment and 5 individual thalli per replicate, resulting in a total sample size of n = 15 per treatment for morphological and photosynthetic measurements. After soaking, the thalli were taken out and continually cultured under the same conditions of 0.02× PES, 10°C, 50 μmol photons m−2 s−1, and a 12 L : 12 D photoperiod with aeration. Chlorophyll fluorescence parameters and thallus area were measured at 0, 5, 10, and 15 d during the cultivation period.

Growth rate

The measurement of growth rate followed our previous studies (Zhong et al. 2023, Ma et al. 2024). Based on images taken by an RGB camera (Nikon, Tokyo, Japan), the area of each thallus was derived using ImageJ software (NIH, Bethesda, MD, USA). The daily growth rate (DGR) was assessed according to the formula:

DGR (%d-1)=[(At/A0)1/t-1]×100

, A0 refers to the initial area and At refers to the area on t days according to Yong et al. (2013).

Photosynthetic parameters

The photosynthetic parameters of P. yezoensis were measured using a chlorophyll fluorescence imaging system FluorCam MF800 (PSI, Brno, Czech Republic), following our previous studies (Du et al. 2022). The parameters which characterized photosynthetic physiology include maximum photochemical efficiency (Fv/Fm), actual photochemical efficiency (ΦPSII), non-photochemical quenching (NPQ), and photochemical quenching (qP).

Effect of extracts on disease resistance

With the culture medium as the control, P. yezoensis thalli were treated with SJEP and AMPEP at the optimum concentrations determined previously. Each treatment consisted of three replicates with 5 individual thalli per replicate, resulting in a total sample size of n = 15 per treatment for morphological and photosynthetic measurements. After the 30-min soaking, the thalli were collected to determine thallus area, photosynthetic parameters, and pigment contents. And the thalli were continually cultured under the same conditions of 0.02× PES, 10°C, 50 μmol photons m−2 s−1, and a 12 L : 12 D photoperiod with aeration, and photosynthetic measurements were taken at 5th day. On the 10th day, the initial activities of superoxide dismutase (SOD) enzyme and content of malondialdehyde (MDA) were determined before infection with P. porphyrae. A spore suspension of P. porphyrae was prepared for the infection stage (Uppalapati et al. 2001). For infection, the P. yezoensis thalli were put in flasks with 500 mL of P. porphyrae spore suspension (1 × 105 spores mL−1) and incubated statically at 15°C for 5 d. On the 15th day, the lesion rate, growth rate, photosynthetic parameters, pigment contents, SOD enzyme activities, and MDA contents were determined for the thalli.

Lesion quantification

The thalli were spread smoothly on a white plate and taken images by RGB camera. The total thalli area and the area of individual lesions were measured using ImageJ software. The percentage of lesion area was calculated according to Zou et al. (2020):

Lesion area (%)=(Total lesion area/Total thalli area)×100

Growth rate and photosynthetic parameters

The measurement of growth rate and photosynthetic parameters were conducted as described above.

Pigment content

The pigment contents of thalli were measured using hyperspectral imaging techniques with estimation models established in our previous study (Che et al. 2023). Thallus samples were evenly spread in a Petri dish under appropriate moisture conditions. Hyperspectral images were acquired using a Specim IQ camera (Specim, Oulu, Finland) under controlled lighting (150-watt halogen lamps at 30 cm distance). The images were processed into spectral data using ENVI 5.3 software (Exelis Visual Information Solutions, Boulder, CO, USA).

Pigment quantification was performed using established machine learning models (Che et al. 2023), with units as mg g−1 fresh weight as following specific approaches:

Phycoerythrin (PE) and chlorophyll-a (Chl-a): Spectral data were preprocessed using Savitzky-Golay (S-G) smoothing and standardization, followed by partial least squares regression modeling.

Phycocyanin (PC) and allophycocyanin (APC): S-G smoothing combined with standard normal variate transformation was applied, and pigment contents were predicted via support vector regression modeling.

All analyses were conducted in MATLAB R2019b (MathWorks, Natick, MA, USA).

Antioxidant substances

The SOD activity was determined on the basis of inhibiting the photochemical reduction of nitroblue tetrazolium (Wang et al. 2010). The measurement followed the manual of SOD activity assay kit (Boxbio, Beijing, China). A 0.1 g sample was homogenized in the extraction solutions at 4°C. The kit reagents were added to the supernatant in sequence, with subsequent incubation at 25°C for 30 min. The absorbance was recorded at 560 nm and the SOD activities were calculated according to the manual, with units as U g−1 fresh weight.

The MDA content was estimated by thiobarbituric acid (TBA) assay (Senthilkumar et al. 2021). The measurement followed manual of MDA assay kit (Boxbio). A 0.1 g sample was extracted by homogenizing with 1 mL extraction buffer at 4°C. The supernatants were collected and reacted with TBA reagents. The absorbance was recorded at 450, 532, and 600 nm using a spectrophotometer (UV-5500; METASH, Shanghai, China). The MDA content was calculated following the manual equation with unit as nmol g−1 fresh weight.

Effects of extracts on cold tolerance

P. yezoensis thalli were treated separately with the optimum concentrations of AMPEP and SJEP by soaking 30 min, with 0.02× PES culture medium as the control. Each treatment had three replicates with 5 individual thalli per replicate, resulting in a total sample size of n = 15 per treatment for morphological and photosynthetic measurements. After soaking, the thalli were cultured in 0.02× PES medium for 24 h at suitable temperature 10°C, then were treated with low temperature at 2°C (referring to our previous study: Ma et al. 2024). The growth rates, photosynthetic parameters, pigment contents, SOD activity, and MDA contents were measured on days 0 and 6 under cold stress. The photosynthetic parameters were also measured on days 1, 2, and 4. The relative expression levels of cold-stress response genes (ABC transporter genes PyABCC1 and PyABCI1) with ACT3 (actin-related protein 3) gene as control were determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) after 24 h cold stress following our previous study (Ma et al. 2024, Tian et al. 2024). The qRT-PCR was performed using HiScript III RT SuperMix for qPCR Kit (Vazyme, Nanjing, China) and SYBR Green qPCR Mix (ABclonal, Wuhan, China). The primers used were as follows: ACT3, forward CAAGCAGAAGGGCATCAT and reverse CCGAGTAGAAAGCGTGGT; PyABCC1 forward GTCGGACCAAGACATGCAG and reverse CGTCACCCACAAGACAGGAA; PyABCI1 forward ACGTGGTGTTGATGGATGAG and reverse CGCCGTCGTGAAGAAATA, respectively. The relative expression levels were calculated by the 2−ΔΔCt method with ACT3 as the internal control.

Determination of bioactive contents in extracts

The SJEP and AMPEP were investigated for the presence of bioactive compounds, including seaweed water-soluble polysaccharides, polyphenols, and pigments of Chl-a and carotenoids. Each measurement set three replicates.

The determination of water-soluble polysaccharides was conducted using the anthrone-sulfuric acid method (Gerwig 2021). The samples were added anthrone reagent (1 : 3) and vortexed. After taking 95°C for 15 min and 0°C for 10 min, the reaction solution was measured its absorbance at 620 nm using a spectrophotometer (UV-5500; METASH). The anhydrous glucose was used as a standard to construct a standard curve. The polysaccharide content of the samples was calculated based on the regression equation.

The polyphenol contents were detected by the Folin-Ciocalteu colorimetric method (Jesumani et al. 2020). The reaction solution was measured its absorbance at 765 nm by spectrophotometry (UV-5500; METASH). The gallic acid was used as a standard to construct a standard curve and regression equation. The polyphenol content of the samples was calculated based on the regression equation.

The pigment contents were decided by spectrophotometry. After removing surface water and weighing the fresh weight, the sample was quickly frozen and ground with liquid nitrogen, then extracted with 80% acetone under dark condition for 1 h. The supernatant of high-speed centrifugation at 10,000 ×g for 10 min (4°C) (HT150R; Cence, Changsha, China) was measured its absorbance at 663, 645, 630, and 440 nm, and the content of Chl-a and carotenoids was calculated by referring to Wellburn (1994).

Statistical analysis

One-way analysis of variance (ANOVA) followed by Duncan’s multiple range test (DMRT) was used to compare the differences among treatments, including the effects of different concentrations of extracts, among the two examined extracts and the control, and the difference of bioactive contents between two extracts. t-test was used to compare difference between two extracts treatment. The statistical significance was evaluated using the standard thresholds of p < 0.05 (significant) and p < 0.01 (highly significant). All statistical analyses were performed using SPSS 20.0 (IBM Corp., Armonk, NY, USA). Data were expressed as mean ± standard deviation.

RESULTS

Effects of different extracts concentration on growth and photosynthesis of Pyropia yezoensis

Under different concentrations of AMPEP and SJEP treatments, the DGR of P. yezoensis exhibited a trend of dose-response curve with initial increase followed by a decrease with the increasing treatment concentrations. The maximum DGR were achieved at 0.05 g L−1 for SJEP and 0.1 g L−1 for AMPEP, reaching 18.77% d−1 and 17.48% d−1, respectively, both were significantly higher than the control groups at 10.32% d−1 and 9.85% d−1 (SJEP, F6,98 = 23.5, p < 0.01; AMPEP, F6,98 = 45.2, p < 0.01) (Fig. 1A & B). Besides 0.05 g L−1, other concentrations of SJEP had no significant improvement on growth of P. yezoensis. For AMPEP, 0.001, 0.01, 0.05 and 0.5 g L−1 also significantly enhanced the growth rate comparing to control (DMRT, p < 0.05).

Fig. 1

Effect of different concentrations of seaweed extracts on daily growth rate (DGR) of Pyropia yezoensis. (A) SJEP (Saccharina japonica extract powder). (B) AMPEP (Ascophyllum marine plant extract powder). Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatment groups (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Among treatments of different concentrations of SJEP, the Fv/Fm increased from day 5 at 0.01 g L−1, and became the highest at 0.05 g L−1 on day 10 and 15 (Fig. 2A). The ΦPSII was significantly higher in treated samples compared to the control, except at a concentration of 0.0005 g L−1 on day 5 and 15, with the highest values observed at 0.05 g L−1 (day 5, F6,98 = 704.5; day 10, F6,98 = 76.4; day 15, F6,98 = 296.6; p < 0.01) (Fig. 2B). The NPQ exhibited irregular variation among different concentrations and control (Fig. 2C). The qP showed trends similar to ΦPSII, with the highest value at 0.05 g L−1 and higher value at 0.001, 0.01, and 0.1 g L−1 (Fig. 2D). Generally, concentrations that were too high (0.5 g L−1) or too low (0.0005 g L−1) had little effect, but a suitable concentration of 0.05 g L−1 could effectively enhance Fv/Fm, ΦPSII, and qP.

Fig. 2

Effect of different concentrations of SJEP (Saccharina japonica extract powder) on photosynthetic parameters of Pyropia yezoensis. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among concentrations at the same time point (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Treated with different concentrations of AMPEP, the Fv/Fm had no much difference among six treatments and the control, except for a slightly increase at day 15 under 0.1 g L−1 (F6,98 = 198.1, p < 0.01) (Fig. 3A). The ΦPSII, NPQ, and qP presented similar trends of variation, raising with the increase in AMPEP concentration, and reaching their highest value at 0.1 g L−1 (Fig. 3B–D).

Fig. 3

Effect of different concentrations of AMPEP (Ascophyllum marine plant extract powder) on photosynthetic parameters of Pyropia yezoensis. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among concentrations at the same time point (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Extract effects on resistance to red rot disease

Lesion quantification

Compared to the control group’s lesion rate of 18.44%, the lesion area (%) of P. yezoensis in the extract treatment groups was highly significantly reduced (F2,42 = 909.2, p < 0.01) (Fig. 4). The SJEP showed a highly significantly lower lesion area (0.83%) than the AMPEP (3.91%) (t28 = 15.4, p < 0.01) (Fig. 4).

Fig. 4

Effect of SJEP (Saccharina japonica extract powder) and AMPEP (Ascophyllum marine plant extract powder) treatments on the lesion area (%) of Pyropia yezoensis infected with Pythium porphyrae. Lesion area was measured as a percentage of thallus damage. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatment groups (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Growth and photosynthetic physiology

The DGR of P. yezoensis after SJEP treatment was the highest at 14.11% d−1, which was highly significantly higher than that of AMPEP treatment at 11.76% d−1 (t28 = 16.4, p < 0.01) (Fig. 5). Both extract treatments had significantly higher DGR than that of the control (F2,42 = 29.2, p < 0.01) (Fig. 5).

Fig. 5

Effects of SJEP (Saccharina japonica extract powder) and AMPEP (Ascophyllum marine plant extract powder) treatments on daily growth rate (DGR) of Pyropia yezoensis under Pythium porphyrae infection. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatment groups (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

P. yezoensis of the control exhibited a general decline in Fv/Fm, ΦPSII, and qP compared to pre-infection, whereas NPQ displayed an initial decrease followed by an increase (Fig. 6). In the SJEP treatment, Fv/Fm and NPQ showed a slightly decrease compared to pre-infection without significant difference, whereas ΦPSII and qP increased, especially on days 10 and 15, which were significantly higher than those in the control group (ΦPSII: day 10, F2,42 = 152.3; day 15, F2,42 = 93.0, p < 0.01; qP: day 10, F2,42 = 23.6, p < 0.01; day 15, F2,42 = 195.4, p < 0.01). The AMPEP treatment showed a trend similar to SJEP but with significantly lower effects (p < 0.05) (Fig. 6).

Fig. 6

Effect on photosynthetic physiology of Pyropia yezoensis under Pythium porphyrae infection. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatments at the same time point (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Photosynthetic pigment contents

Compared to the beginning, the contents of PE, PC, and Chl-a in P. yezoensis highly significantly decreased after 15 d (p < 0.01), meanwhile APC content significantly increased (p < 0.05) (Table 1). Except PE, the decreased degrees of PC and Chl-a contents were significantly smaller in SJEP than in AMPEP treatment (p < 0.05). The increased degree of APC content was significantly larger in SJEP than in AMPEP treatment (p < 0.05). Both extract treatments had lower variation degree than the control (p < 0.05) (Table 1).

Pigment contents of Pyropia yezoensis with different treatments under Pythium porphyrae infection

SOD and MDA

Compared to before infection, the activity of SOD in P. yezoensis significantly increased in all treatment after infection (t4 = 41.0, t4 = 82.2, t4 = 60.7, p < 0.01) (Fig. 7A). Meanwhile the content of MDA only significantly increased in the control (t4 = 6.1, p = 0.02), with a slight increase in the extract treatment (Fig. 7B). The SOD activity in SJEP was significantly higher than in AMPEP (t4 = 16.7, p < 0.01), and both were significantly higher than in the control (F2,6 = 10.2, p < 0.05) (Fig. 7A). The MDA content in the SJEP treatment was significantly lower than in the AMPEP (t4 = 6.9, p < 0.05), and both extract treatments were significantly lower than in the control (F2,6 = 10.1, p < 0.05).

Fig. 7

Variation of superoxide dismutase (SOD) activity and malondialdehyde (MDA) content in Pyropia yezoensis with different treatments under Pythium porphyrae infection. (A) SOD activity. (B) MDA content. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences among treatments at the time point (p < 0.05).

Extract effects on cold tolerance

Growth and photosynthetic physiology

Under cold stress, the DGR of SJEP treatment was significantly higher at 11.34% d−1 compared to AMPEP treatment at 9.37% d−1 (t28 = 16.4, p < 0.01), both exceeding the control’s 5.06% d−1 (F2,42 = 679.9, p < 0.01) (Fig. 8).

Fig. 8

Effect of different treatments on daily growth rate (DGR) of Pyropia yezoensis under cold stress. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatments (p < 0.05).

The Fv/Fm of the SJEP treatment exhibited a significantly higher value compared to both the control and AMPEP treatments on day 1, and 4 during cold stress period (day 1, F2,42 = 114.4; day 4, F2,42 = 93.5; p < 0.01) (Fig. 9A). The ΦPSII of the SJEP treatment was also higher than that observed in the control and AMPEP treatments on days 0 and 1 of cold stress (day 0, F2,42 = 14.7, p < 0.01; day 1, F2,42 = 5.3; p < 0.05), with no significant differences noted subsequently (Fig. 9B). The NPQ showed an overall downward trend under cold stress condition. The extract-treated groups demonstrated lower NPQ than the control group on days 1 and 2. However, on days 4 and 6, the SJEP treatment exhibited significantly higher NPQ compared to both AMPEP and the control treatments (day 4, F2,42 = 35.7, p < 0.01; day 6, F2,42 = 11.9, p < 0.01) (Fig. 9C). Similarly, the qP displayed a general decline (Fig. 9D). The SJEP treatment maintained significantly higher qP than the control and AMPEP treatments on day 4, and 6 of cold stress (day 4, F2,42 = 35.6, p < 0.01; day 6, F2,42 = 11.4, p < 0.01).

Fig. 9

Effects of seaweed extracts on photosynthetic physiology of Pyropia yezoensis under cold stress. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatments at the same time point (p < 0.05).

Photosynthetic pigment content

After 6 d of cold stress, the PE, PC, and Chl-a contents in the thalli were highly significantly reduced in all treatment groups (p < 0.01), but the APC highly significantly increased (p < 0.01) (Table 2). Except Chl-a, the variation degree of PE, PC, and APC content were significantly less in the SJEP treatment compared to the AMPEP treatment (p < 0.05). These changes of two extract treatments were significantly less than those of control (p < 0.05) (Table 2).

Pigment contents of Pyropia yezoensis with different treatments under cold stress

SOD and MDA

After 6 d of cold stress, the SOD activity decreased and the MDA content increased in P. yezoensis. However, the SOD activities in two extract treatments were significantly higher, as compared to the control (F2,6 = 15.0, p < 0.01), with the SJEP significantly higher than AMPEP treatment (t4 = 9.1, p < 0.01) (Fig. 10A). On the other hand, the MDA content in SJEP treatment was significantly lower than that in AMPEP treatment (t4 = 5.0, p < 0.01), and both were significantly lower than the MDA content observed in the control (F2,6 = 38.0, p < 0.01) (Fig. 10B).

Fig. 10

Variation of superoxide dismutase (SOD) activity (A) and malondialdehyde (MDA) content (B) in Pyropia yezoensis with different treatments under cold stress. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences among treatments at the same time point (p < 0.05).

Expression of cold-stress response genes

Under cold stress, the expression of two cold response genes, PyABCC1 and PyABCI1 in P. yezoensis were highly significantly upregulated upon treatment with seaweed extracts as compared to the control (F2,6 = 3,800.8 and F2,6 = 533.4; p < 0.01) (Fig. 11). The gene expression levels of SJEP and AMPEP treatment were more than 5-fold and 3-fold, respectively, than those of the control. Moreover, the expression levels in SJEP-treated samples were significantly higher than those in AMPEP-treated samples (t4 = 43.0, p < 0.01 and t4 = 6.2, p < 0.01), indicating a more pronounced effect of SJEP on the upregulation of these cold response genes.

Fig. 11

Relative expression levels of cold-responsive genes in Pyropia yezoensis with different treatments under cold stress. (A) PyABCC1. (B) PyABCI1. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences among treatments (p < 0.05).

Bioactive contents of SJEP and AMPEP

The SJEP had highly higher contents of polysaccharide, phenol, and Chl-a than AMPEP, but highly lower in carotenoid content (t4 value = 383.6, 241.5, 354.2, and 242.5, respectively, p < 0.01) (Table 3).

Contents of main bioactive substances in seaweed extracts of SJEP and AMPEP (μg g−1)

DISCUSSION

Seaweed extracts, particularly those derived from brown algae, have been widely applied in agriculture as eco-friendly biostimulants due to their ability to promote growth and resistance to environmental stresses and diseases (Khan et al. 2009, Critchley et al. 2021, Margal et al. 2023). The preference for several brown algae in commercial applications stems from their higher natural biomass and aquaculture yield especially compared to red and green algae (Khan et al. 2009, Critchley et al. 2021). The polysaccharide content in brown algae, predominantly laminarin, fucoidan, and kelp starch, plays a crucial role in enhancing plant growth and photosynthesis, as well as in improving stress resistance (Bouissil et al. 2020, Mamede et al. 2023). Additionally, the rich organic compounds present in brown algae, including organic acids, polyphenols, and mannitol, significantly contribute to the improved nutrient uptake and utilization by crops, thereby promoting growth (Khan et al. 2009, Krautforst et al. 2023). In our study, SJEP at 0.05 g L−1 and AMPEP at 0.1 g L−1 were determined to be the optimal concentrations for P. yezoensis, with SJEP requiring a lower concentration for equivalent effects. This suggests that SJEP is more potent than AMPEP when applied at their respective optimal concentrations. The superior growth, photosynthesis, red rot, and cold tolerance observed in P. yezoensis treated with SJEP were correlated with its higher content of soluble polysaccharides, polyphenols, and Chl-a compared to AMPEP. This correlation suggests a potential contribution of these components, but future fractionation or removal experiments are required to confirm causation. Besides, in this study, SJEP is an enzymatic extract that uses an enzyme capable of efficiently decomposing the cell wall of brown algae to extract bioactive substances in a more environmentally friendly way, unlike most commercial products such as AMPEP, which rely on alkaline or acidic chemicals for extraction. Generally, the findings implied the importance of the quantity of active substances in biostimulants for their efficacy in enhancing plant or algae performance under various stress conditions. According to our result, the seaweed extracts enhanced P. yezoensis growth by ~5% under cold condition and ~10% at optimal temperature. In addition to growth promotion, SJEP and AMPEP significantly reduced the infection rate compared to the control (18.44%), to 0.83% (−17.61%p) and 3.91% (−14.53%p), respectively, demonstrating a potent disease suppression effect. For practical cultivation, pre-treatment of seedling ropes through extract soaking prior to maritime deployment could provide a scalable and cost-effective implementation method. This combined improvement in growth performance and disease resistance would increase crop yields while reducing economic losses.

Seaweed extracts are widely recognized for their role in promoting growth and photosynthesis, which has been a focal point of extensive research and application in agriculture (Khan et al. 2009, Margal et al. 2023). The study by Chanthini et al. (2024) has demonstrated that extracts from brown algae Sargassum wightii effectively enhance the activity of SOD and the content of chlorophyll in rice, thereby promoting photosynthetic activity in leaves and root system growth. Similar positive effects have been observed in wheat under drought stress, where a 2% Sargassum denticulatum extract improved growth and yield parameters while increasing organic solute and phenolic content in leaves (Ali et al. 2022). Separately, Ecklonia maxima seaweed extracts (Afrikelp) were shown to enhance maize growth and reduce electrolyte leakage under salinity stress, with metabolomic profiling revealing significant adjustments in amino acids, sugars, and organic acids for stress mitigation (Pienaar et al. 2025). In the present study, both SJEP and AMPEP, which are brown algae extracts, demonstrated their ability to stimulate the growth and photosynthesis of P. yezoensis. The growth-promoting effect on P. yezoensis was observed to increase and then decrease with the concentration of both extracts, reaching the highest at 0.05 g L−1 for SJEP and 0.1 g L−1 for AMPEP. Moreover, both SJEP and AMPEP generally improved the photosynthetic efficiency of P. yezoensis, primarily reflected in the enhancement of photosynthetic parameters ΦPSII and qP, reaching their peak values at their respective optimal concentrations.

The findings of this study corroborate the efficacy of seaweed extracts in augmenting the photosynthetic efficiency of photosynthetic organisms and in fostering growth. As a red alga, P. yezoensis relies on phycobiliproteins and chlorophyll, the principal constituents of its photosynthetic pigments, to determine the efficiency of light absorption and utilization (Blouin et al. 2011, Zheng et al. 2020). Chl-a, central to the photosynthetic process, is directly implicated in the dynamics of photosynthesis (Björn et al. 2009, Mandal and Dutta 2020). Phycobiliproteins, which are light-harvesting pigment-proteins, are primarily involved in facilitating light absorption (Yan et al. 2000, Liu et al. 2024). The concentration of PC within phycobiliproteins is positively correlated with its antioxidant capacity (Estrada et al. 2001, Fernández-Rojas et al. 2014). Under the Pythium infection and low-temperature stress, this study observed a significant reduction in the pigment content of PE, PC, and Chl-a in P. yezoensis, indicating a decreased capacity for light absorption and photosynthetic efficiency. Conversely, an increase in APC content may be associated with stress response and resistance mechanisms. Treatment with SJEP and AMPEP not only mitigated the alterations in pigment content under stress but also conferred higher ΦPSII, NPQ, and qP values compared to the control, thereby significantly alleviating the adverse effects of stress on photosynthetic efficiency. Analogous effects have been documented in the response of cultivated seaweeds to Kelpak or AMPEP, including enhancements in PE and PC contents, photosynthesis, and a deepening of color in Saccharina sporophytes (Loureiro et al. 2014, Umanzor et al. 2020, Shin et al. 2024).

Seaweed extracts also have benefits for assisting plants in resistance to biotic stress and tolerance to abiotic stress (De Saeger et al. 2019, Shukla et al. 2019). In economic macroalgae, seaweed extracts have been applied to reduce the incidence of “ice-ice” and epi-endophytism for Kappaphycus species (Borlongan et al. 2011, Cottier-Cook et al. 2016, Marroig et al. 2016, Ali et al. 2018). In this study, during the Pythium infection experiment, the lesion rate of P. yezoensis treated with SJEP and AMPEP was significantly lower than that of the control, concurrent with a significantly enhanced growth rate. The amelioration of the impact on photosynthesis and pigmentation, as detailed earlier, was also pronounced. In terms of physiological responses to stress, MDA and SOD emerge as pivotal biochemical markers. MDA levels serve as an indicator of cellular damage, with higher levels suggesting greater membrane peroxidation (Morales and Munné-Bosch 2019, Zhu et al. 2022). Conversely, SOD, an antioxidant enzyme, safeguards cells and tissues from oxidative stress, with its activity typically reflecting the degree of stress (Alscher et al. 2002, Rezayian et al. 2019). In this study, after infection by Pythium, a notable surge in SOD activity was recorded in P. yezoensis, with extracts treated samples showing a significantly higher increase than the control. This elevation in SOD activity in SJEP- and AMPEP-treated P. yezoensis corroborates the positive correlation between SOD levels and disease resistance, suggesting that seaweed extracts bolster the alga’s resistance by upregulating SOD activity. Conversely, Pythium infection led to an increase in MDA content; however, the MDA levels in SJEP- and AMPEP-treated P. yezoensis were marginally elevated and substantially lower than those in the control. This reduction in MDA content indicates that seaweed extracts can mitigate the cellular membrane damage inflicted by biological invasion, thereby augmenting the disease resistance of P. yezoensis. On the other hand, Pythium infection also caused an increase of MDA content in P. yezoensis, however, compared to the control, this increase in extract treatments was slightly and significantly lower than that in the control. This comparative reduction of MDA content indicates that seaweed extracts can mitigate the cellular membrane damage inflicted by biological invasion, thereby enhancing disease resistance.

Under abiotic stress, seaweed extracts not only promote the growth and photosynthesis of plants and algae, but also stimulate their resistance mechanism physiologically and transcriptionally. The sulphated polysaccharides in these extracts exhibit a remarkable capacity to scavenge ROS, thereby mitigating oxidative damage in halophytes exposed to high NaCl concentrations (Bose et al. 2014). Burritt et al. (2002) observed an elevated antioxidant enzyme activity in Stictosiphonia arbuscula growing at varying tidal levels, displayed enhanced stress tolerance. In this study, although declined under cold stress, the activity of SOD enzymes in SJEP- and AMPEP-treated P. yezoensis was higher than that in the control group, both before and after stress exposure. MDA, a biomarker for membrane lipid peroxidation, significantly increased under cold stress, suggesting that cellular membrane lipids and cytoplasmic membrane structure were still susceptible to peroxidation and damage under stress conditions. However, the significantly lower MDA content in P. yezoensis treated with SJEP and AMPEP confirmed the protective effect of seaweed extracts on stress resistance. Interestingly, in contrast to the significant increase observed under Pythium infection, the activity of SOD, an enzyme, was markedly inhibited under cold temperatures. This inhibition of SOD seems to be compensated by an increase in MDA levels, which may serve as a protective mechanism for P. yezoensis.

Brown algae, known for their rich polyphenol content, contribute significantly to crop stress resistance through their antioxidant properties (Khan et al. 2009, Krautforst et al. 2023, Zagoskina et al. 2023). In this study, SJEP, with a higher polyphenol content than AMPEP, demonstrated superior effects on disease resistance and cold tolerance, highlighting the role of polyphenols in stress and disease resistance. Additionally, the growth rate (DGR), photosynthetic efficiency (ΦPSII, NPQ, and qP), and pigment content (PE, PC, and Chl-a) of SJEP- and AMPEP-treated P. yezoensis under cold stress were superior to those of the untreated control. At the transcriptional level, the expression of cold-responsive genes PyABCC1 and PyABCI1 in SJEP- and AMPEP-treated P. yezoensis was significantly upregulated compared to the control. Collectively, these findings from growth, photosynthetic physiology, biochemical composition, and gene expression underscore the multifaceted role of seaweed extracts in bolstering the stress resistance of P. yezoensis.

This study demonstrated that the optimally concentrated seaweed extracts AMPEP (0.1 g L−1) and SJEP (0.05 g L−1) significantly enhanced the growth, photosynthetic performance, and stress tolerance of Pyropia yezoensis. These extracts not only improved the DGR and photosynthetic efficiency, but also effectively mitigated the impacts of red rot disease and cold stress on physiological and biochemical parameters. The treatments were particularly effective in reducing the red rot lesion rate and enhancing the expression of cold-responsive genes (PyABCC1 and PyABCI1) under stress conditions. Notably, SJEP outperformed AMPEP at lower concentrations, which could be attributed to its higher content of bioactive compounds including soluble polysaccharides and polyphenols. These findings highlight the potential of AMPEP and SJEP as valuable biostimulants for P. yezoensis cultivation, demonstrating their ability to improve both productivity and stress resilience under challenging environmental conditions.

Notes

ACKNOWLEDGEMENTS

This work was supported by National Key Research and Development Program of China (2022YFD2400105, 2023YFD2400101). We thank X. F. Zhong and Z. X. Huang for help in investigation during their study in our laboratory as students.

CONFLICTS OF INTEREST

Yan-Jun Gong, a co-author of this study, is from Weifang Macroalga Biotech, however, the company had no role in the study design, data collection and analysis, interpretation of the results, manuscript writing, or the decision to publish. The other authors declare no competing interests.

SUPPLEMENTARY MATERIALS

Supplementary Table S1. Pigment contents of Pyropia yezoensis with different treatments under Pythium porphyrae infection (https://e-algae.org).

Supplementary Table S2. Pigment contents of Pyropia yezoensis with different treatments under cold stress (https://e-algae.org).

algae-2025-40-8-28-Supplementary-Table.pdf

References

Ali A. H., Said E. M., Abdelgawad Z. A.. 2022;The role of seaweed extract on improvement drought tolerance of wheat revealed by osmoprotectants and DNA (cpDNA) markers. Braz. J. Bot 45:857–867. doi.org/10.1007/s40415-022-00820-5.
Ali M. K. M., Yashir S. M., Critchley A. T., Hurtado A. Q.. 2018;Impacts of Ascophyllum marine plant extract powder (AMPEP) on the growth, incidence of the endophyte Neosiphonia apiculata and associated carrageenan quality of three commercial cultivars of Kappaphycus. J. Appl. Phycol 30:1185–1195. doi.org/10.1007/s10811-017-1312-2.
Ali O., Ramsubhag A., Jayaraman J.. 2021;Phytoelicitor activity of Sargassum vulgare and Acanthophora spicifera extracts and their prospects for use in vegetable crops for sustainable crop production. J. Appl. Phycol 33:639–651.
Alscher R. G., Erturk N., Heath L. S.. 2002;Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot 53:1331–1341. doi.org/10.1093/jexbot/53.372.1331.
Besednova N. N., Andryukov B. G., Zaporozhets T. S., et al. 2021;Antiviral effects of polyphenols from marine algae. Biomedicines 9:200.
Björn L. O., Papageorgiou G. C., Blankenship R. E., Govindjee . 2009;A viewpoint: why chlorophyll a? Photosynth. Res 99:85–98. doi.org/10.1007/s11120-008-9395-x.
Blouin N. A., Brodie J. A., Grossman A. C., Xu P., Brawley S. H.. 2011;Porphyra: a marine crop shaped by stress. Trends Plant Sci 16:29–37. doi.org/10.1016/j.tplants.2010.10.004.
Borlongan I. A. G., Tibubos K. R., Yunque D. A. T., Hurtado A. Q., Critchley A. T.. 2011;Impact of AMPEP on the growth and occurrence of epiphytic Neosiphonia infestation on two varieties of commercially cultivated Kappaphycus alvarezii grown at different depths in the Philippines. J. Appl. Phycol 23:615–621. doi.org/10.1007/s10811-010-9649-9.
Bose J., Rodrigo-Moreno A., Shabala S.. 2014;ROS homeostasis in halophytes in the context of salinity stress tolerance. J. Exp. Bot 65:1241–1257. doi.org/10.1093/jxb/ert430.
Bouissil S., El Alaoui-Talibi Z., Pierre G., et al. 2020;Fucoidans of Moroccan brown seaweed as elicitors of natural defenses in date palm roots. Mar. Drugs 18:596. doi.org/10.3390/md18120596.
Burritt D. J., Larkindale J., Hurd C. L.. 2002;Antioxidant metabolism in the intertidal red seaweed Stictosiphonia arbuscula following desiccation. Planta 215:829–838. doi.org/10.1007/s00425-002-0805-6.
Chanthini KM-P, Pavithra G.-S., Murugan P., et al. 2024;Management of excessive soil H+ ion induced toxicities by application of organic seaweed amendment enhances photosynthesis and resource use efficiencies in rice (Oryza sativa). Environ. Res 247:118179. doi.org/10.1016/j.envres.2024.118179.
Che S., Du G., Zhong X., Mo Z., Wang Z., Mao Y.. 2023;Quantification of photosynthetic pigments in Neopyropia yezoensis using hyperspectral imagery. Plant Phenomics 5:0012.
Cottier-Cook E. J., Nagabhatla N., Badis Y., et al. 2016. Safeguarding the future of the global seaweed aquaculture industry United Nations University Institute of Water, Environment and Health and Scottish Association for Marine Science. Hamilton, ON: p. 1–12.
Critchley A. T., Critchley J. S. C., Norrie J., Gupta S., Van Staden J.. 2021. Chapter 13 - Perspectives on the global biostimulant market: applications, volumes, and values, 2016 data and projections to 2022. In : Gupta S., Van Staden J., eds. Biostimulants for Crops from Seed Germination to Plant Development: A Practical Approach Academic Press. Salt Lake City, UT: p. 289–296.
De Saeger J., Van Praet S., Vereecke D., et al. 2019;Toward the molecular understanding of the action mechanism of Ascophyllum nodosum extracts on plants. J. Appl. Phycol 32:573–597. doi.org/10.1007/s10811-019-01903-9.
Du G., Li X., Wang J., Che S., Zhong X., Mao Y.. 2022;Discrepancy in photosynthetic responses of the red alga Pyropia yezoensis to dehydration stresses under exposure to desiccation, high salinity, and high mannitol concentration. Mar. Life Sci. Technol 4:10–17. doi.org/10.1007/s42995-021-00115-w.
Estrada J. E. P., Bescós P. B., Del Fresno A. M. V.. 2001;Antioxidant activity of different fractions of Spirulina platensis protean extract. Farmaco 56:497–500. doi.org/10.1016/S0014-827X(01)01084-9.
Fernández-Rojas B., Hernández-Juárez J., Pedraza-Chaverri J.. 2014;Nutraceutical properties of phycocyanin. J. Funct. Foods 11:375–392. doi.org/10.1016/j.jff.2014.10.011.
Food and Agriculture Organization of the United Nations. 2023. Fishery and aquaculture statistics yearbook 2020. FAO Yearbook of Fishery and Aquaculture Statistics FAO; Rome: Available from: doi.org/10.4060/cc7493en. Accessed Dec 1, 2023.
Gerwig G. J.. 2021. Detection of carbohydrates by colorimetric methods. In : Kalyuzhny A. E., ed. The Art of Carbohydrate Analysis. Techniques in Life Science and Biomedicine for the Non-Expert Springer. Cham: p. 61–88.
Han S., Park J.-S., Umanzor S., Yarish C., Kim J. K.. 2022;Effects of extraction methods for a new source of biostimulant from Sargassum horneri on the growth of economically important red algae, Neopyropia yezoensis. Sci. Rep 12:11878.
Hurtado A. Q., Critchley A. T.. 2020. Chapter 4 - Time for applications of biostimulants in phyconomy: seaweed extracts for enhanced cultivation of seaweeds (SEECS). In : Torres M. D., Kraan S., Dominguez H., eds. Advances in Green and Sustainable Chemistry. Sustainable Seaweed Technologies: Cultivation, Biorefinery, and Applications Elsevier. Amsterdam: p. 103–127. doi.org/10.1016/B978-0-12-817943-7.00024-X.
Jesumani V., Du H., Pei P., Aslam M., Huang N.. 2020;Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum. PLoS ONE 15:e0227308. doi.org/10.1371/journal.pone.0227308.
Jung J. W., Dittrich M., Umanzor S., Kim J. K.. 2025;Influence of Sargassum horneri extract (SHE) pre-treatment and nutrient availability on the thermal tolerance of Palmaria hecatensis. J. Appl. Phycol 37:617–628. doi.org/10.1007/s10811-024-03419-3.
Khan W., Rayirath U. P., Subramanian S., et al. 2009;Seaweed extracts as biostimulants of plant growth and development. J. Plant Growth Regul 28:386–399. doi.org/10.1007/s00344-009-9103-x.
Krautforst K., Szymczycha-Madeja A., Wełna M., Michalak I.. 2023;Brown seaweed: Fucus vesiculosus as a feedstock for agriculture and environment protection. Sci. Rep 13:10065. doi.org/10.1038/s41598-023-36881-z.
Liu R., Zhen Z.-H., Li W., Ge B., Qin S.. 2024;How can Phycobilisome, the unique light harvesting system in certain algae working highly efficiently: the connection in between structures and functions. Prog. Biophys. Mol. Biol 186:39–52. doi.org/10.1016/j.pbiomolbio.2023.11.005.
Loureiro R. R., Reis R. P., Marroig R. G.. 2014;Effect of the commercial extract of the brown alga Ascophyllum nodosum Mont. on Kappaphycus alvarezii (Doty) Doty ex P.C. Silva in situ submitted to lethal temperatures. J. Appl. Phycol 26:629–634. doi.org/10.1007/s10811-013-0085-5.
Ma L.-H., Tian L., Wang Y.-Q., Xie C.-Y., Du G.-Y.. 2024;Physiological and transcriptome analysis of acclimatory response to cold stress in marine red alga Pyropia yezoensis. Algae 39:17–30. doi.org/10.4490/algae.2024.39.3.7.
Mamede M., Cotas J., Bahcevandziev K., Pereira L.. 2023;Seaweed polysaccharides in agriculture: a next step towards sustainability. Appl. Sci 13:6594. doi.org/10.3390/app13116594.
Mandal R., Dutta G.. 2020;From photosynthesis to biosensing: chlorophyll proves to be a versatile molecule. Sens. Int 1:1000058. doi.org/10.1016/j.sintl.2020.100058.
Margal P. B., Thakare R. S., Kamble B. M., Patil V. S., Patil K. B., Titirmare N. S.. 2023;Effect of seaweed extracts on crop growth and soil: a review. J. Exp. Agric. Int 45:9–19.
Marroig R. G., Loureiro R. R., Reis R. P.. 2016;The effect of Ascophyllum nodosum (Ochrophyta) extract powder on the epibiosis of Kappaphycus alvarezii (Rhodophyta) commercially cultivated on floating rafts. J. Appl. Phycol 28:2471–2477. doi.org/10.1007/s10811-016-0865-9.
Morales M., Munné-Bosch S.. 2019;Malondialdehyde: facts and artifacts. Plant Physiol 180:1246–1250. doi.org/10.1104/pp.19.00405.
Pienaar B. C., Majeke B. M., Wittenberg M. F., et al. 2025;Mitigating salt stress in maize using Ecklonia maxima seaweed extracts. Plant Stress 16:100828.
Rezayian M., Niknam V., Ebrahimzadeh H.. 2019;Oxidative damage and antioxidative system in algae. Toxicol. Rep 6:1309–1313.
Robertson-Andersson D. V., Leitao D., Bolton J. J., Anderson R. J., Njobeni A., Ruck K.. 2006;Can kelp extract (KELPAK®) be useful in seaweed mariculture. J. Appl. Phycol 18:315–321. doi.org/10.1007/s10811-006-9030-1.
Senthilkumar M., Amaresan N., Sankaranarayanan A.. 2021. Estimation of malondialdehyde (MDA) by thiobarbituric acid (TBA) assay. In : Senthilkumar M., Amaresan N., Sankaranarayanan A., eds. Plant-Microbe Interactions. Springer Protocols Handbooks Humana. New York: p. 103–105. doi.org/10.1007/978-1-0716-1080-0_25.
Shahrajabian M. H., Chaski C., Polyzos N., Petropoulos S. A.. 2021;Biostimulants application: a low input cropping management tool for sustainable farming of vegetables. Biomolecules 11:698. doi.org/10.3390/biom11050698.
Shin S. K., Xing Q., Park J.-S., Yarish C., Kong F., Kim J. K.. 2024;Effects of biostimulants, AMPEP and Kelpak on the growth and asexual reproduction of Pyropia yezoensis (Bangiales, Rhodophyta) at different temperatures. Algae 39:31–41. doi.org/10.4490/algae.2024.39.3.11.
Shukla P. S., Mantin E. G., Adil M., Bajpai S., Critchley A. T., Prithiviraj B.. 2019;Ascophyllum nodosum-based biostimulants: sustainable applications in agriculture for the stimulation of plant growth, stress tolerance and disease management. Front. Plant Sci 10:655. doi.org/10.3389/fpls.2019.00655.
Sulmon C., Gouesbet G., El Amrani A., Couée I.. 2006;Sugar-induced tolerance to the herbicide atrazine in Arabidopsis seedlings involves activation of oxidative and xenobiotic stress responses. Plant Cell Rep 25:489–498. doi.org/10.1007/s00299-005-0062-9.
Tang L., Qiu L., Liu C., et al. 2019;Transcriptomic insights into innate immunity responding to red rot disease in red alga Pyropia yezoensis. Int. J. Mol. Sci 20:5970. doi.org/10.3390/ijms20235970.
Tian L., Wu L., Zhong X.-F., Ma L.-H., Du G.-Y.. 2024;Genome-wide characterization of ABC transporter genes and expression profiles in red macroalga Pyropia yezoensis expose to low-temperature. Mar. Biotechnol 26:1179–1193. doi.org/10.1007/s10126-024-10355-3.
Umanzor S., Shin S., Marty-Rivera M., Augyte S., Yarish C., Kim J. K.. 2019;Preliminary assessment on the effects of the commercial seaweed extract, AMPEP, on growth and thermal tolerance of the kelp Saccharina spp. from the Northwest Atlantic. J. Appl. Phycol 31:3823–3829. doi.org/10.1007/s10811-019-01852-3.
Umanzor S., Shin S., Yarish C., Augyte S., Kim J. K.. 2020;Exploratory evaluation of the effects of Kelpak® seaweed extract on cultivated kelp Saccharina spp. exposed to sublethal and lethal temperatures. J. World Aquacult. Soc 51:960–969. doi.org/10.1111/jwas.12687.
Uppalapati S. R., Kerwin J. L., Fujita Y.. 2001;Epifluorescence and scanning electron microscopy of host-pathogen interactions between Pythium porphyrae (Peronosporales, Oomycota) and Porphyra yezoensis (Bangiales, Rhodophyta). Bot. Mar 44:139–145. doi.org/10.1515/BOT.2001.019.
Wang X., Chen S., Zhang H., et al. 2010;Desiccation tolerance mechanism in resurrection fern-ally Selaginella tamariscina revealed by physiological and proteomic analysis. J. Proteome Res 9:6561–6577. doi.org/10.1021/pr100767k.
Wellburn A. R.. 1994;The spectral determination of chlorophylls a and b, as well as total carotenoids, using various solvents with spectrophotometers of different resolution. J. Plant Physiol 144:307–313. doi.org/10.1016/S0176-1617(11)81192-2.
Williams B., Njaci I., Moghaddam L., et al. 2015;Trehalose accumulation triggers autophagy during plant desiccation. PLoS Genet 11:e1005705. doi.org/10.1371/journal.pgen.1005705.
Xing Q., Han S., Park J.-S., Yarish C., Kim J. K.. 2023;Comparative transcriptome analysis reveals the molecular mechanism of heat-tolerance in Neopyropia yezoensis induced by Sargassum horneri extract. Front Mar. Sci 10:1142483. doi.org/10.3389/fmars.2023.1142483.
Yan X.-H., Fujita Y., Aruga Y.. 2000;Induction and characterization of pigmentation mutants in Porphyra yezoensis (Bangiales, Rhodophyta). J. Appl. Phycol 12:69–81. doi.org/10.1023/A:1008129119065.
Yong Y. S., Yong W. T. L., Anton A.. 2013;Analysis of formulae for determination of seaweed growth rate. J. Appl. Phycol 25:1831–1834. doi.org/10.1007/s10811-013-0022-7.
Zagoskina N. V., Zubova M. Y., Nechaeva T. L., et al. 2023;Polyphenols in plants: structure, biosynthesis, abiotic stress regulation, and practical applications. Int. J. Mol. Sci 24:13874. doi.org/10.3390/ijms241813874.
Zeb A., Khan Y., Yang X., He H., Fu C., Shen S.. 2024;Impact of temperature stress on Pyropia yezoensis and its inhabitant microbiota to promote aquaculture. Environ. Adv 16:100532. doi.org/10.1016/j.envadv.2024.100532.
Zheng Z., Gu W., Gao S., Wang G.. 2020;Characterization of photosynthetic protein complexes in conchocelis and blades of Pyropia yezoensis (Rhodophyta). Algal Res 48:101922. doi.org/10.1016/j.algal.2020.101922.
Zhong X., Che S., Xie C., et al. 2023;Physiological response of red macroalgae Pyropia yezoensis (Bangiales, Rhodophyta) to light quality: a short-term adaptation. Algae 38:141–150. doi.org/10.4490/algae.2023.38.5.25.
Zhu S., Gu D., Lu C., et al. 2022;Cold stress tolerance of the intertidal red alga Neoporphyra haitanensis. BMC Plant Biol 22:114. doi.org/10.1186/s12870-022-03507-x.
Zou D., Tang X., Qiu L., Mao Y.. 2020;Defensive physiological characters of Pyropia yezoensis resistant lines to the red rot disease. J. Oceanol. Limnol 38:509–516. doi.org/10.1007/s00343-019-9144-3.
Zou P., Lu X., Zhao H., et al. 2019;Polysaccharides derived from the brown algae Lessonia nigrescens enhance salt stress tolerance to wheat seedlings by enhancing the antioxidant system and modulating intracellular ion concentration. Front. Plant Sci 10:48. doi.org/10.3389/fpls.2019.00048.

Article information Continued

Fig. 1

Effect of different concentrations of seaweed extracts on daily growth rate (DGR) of Pyropia yezoensis. (A) SJEP (Saccharina japonica extract powder). (B) AMPEP (Ascophyllum marine plant extract powder). Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatment groups (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Fig. 2

Effect of different concentrations of SJEP (Saccharina japonica extract powder) on photosynthetic parameters of Pyropia yezoensis. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among concentrations at the same time point (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Fig. 3

Effect of different concentrations of AMPEP (Ascophyllum marine plant extract powder) on photosynthetic parameters of Pyropia yezoensis. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among concentrations at the same time point (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Fig. 5

Effects of SJEP (Saccharina japonica extract powder) and AMPEP (Ascophyllum marine plant extract powder) treatments on daily growth rate (DGR) of Pyropia yezoensis under Pythium porphyrae infection. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatment groups (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Fig. 4

Effect of SJEP (Saccharina japonica extract powder) and AMPEP (Ascophyllum marine plant extract powder) treatments on the lesion area (%) of Pyropia yezoensis infected with Pythium porphyrae. Lesion area was measured as a percentage of thallus damage. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatment groups (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Fig. 6

Effect on photosynthetic physiology of Pyropia yezoensis under Pythium porphyrae infection. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatments at the same time point (one-way ANOVA followed by Duncan’s multiple range test, p < 0.05).

Fig. 7

Variation of superoxide dismutase (SOD) activity and malondialdehyde (MDA) content in Pyropia yezoensis with different treatments under Pythium porphyrae infection. (A) SOD activity. (B) MDA content. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences among treatments at the time point (p < 0.05).

Fig. 8

Effect of different treatments on daily growth rate (DGR) of Pyropia yezoensis under cold stress. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatments (p < 0.05).

Fig. 9

Effects of seaweed extracts on photosynthetic physiology of Pyropia yezoensis under cold stress. (A) Maximum photochemical efficiency (Fv/Fm). (B) Actual photochemical efficiency (ΦPSII). (C) Non-photochemical quenching (NPQ). (D) Photochemical quenching (qP). SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 15). Different lowercase letters indicate significant differences among treatments at the same time point (p < 0.05).

Fig. 10

Variation of superoxide dismutase (SOD) activity (A) and malondialdehyde (MDA) content (B) in Pyropia yezoensis with different treatments under cold stress. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences among treatments at the same time point (p < 0.05).

Fig. 11

Relative expression levels of cold-responsive genes in Pyropia yezoensis with different treatments under cold stress. (A) PyABCC1. (B) PyABCI1. SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder. Data represent mean ± standard deviation (n = 3). Different lowercase letters indicate significant differences among treatments (p < 0.05).

Table 1

Pigment contents of Pyropia yezoensis with different treatments under Pythium porphyrae infection

Pigment content (mg g−1) Control SJEP AMPEP



Start End End-Start Start End End-Start Start End End-Start
PE 9.44 ± 0.17 4.22 ± 0.3** −5.22 ± 0.07a 9.6 ± 0.13 6.14 ± 0.03** −3.46 ± 0.08b 9.15 ± 0.15 5.62 ± 0.13** −3.53 ± 0.08b
PC 6.73 ± 0.12 2.76 ± 0.05** −3.97 ± 0.06a 6.25 ± 0.09 3.18 ± 0.03** −3.07 ± 0.07c 6.48 ± 0.17 2.91 ± 0.07** −3.57 ± 0.06b
APC 6.71 ± 0.03 8.59 ± 0.11** 1.88 ± 0.05a 6.31 ± 0.16 6.84 ± 0.11** 0.53 ± 0.03b 6.77 ± 0.11 6.89 ± 0.13* 0.12 ± 0.02c
Chl-a 2.25 ± 0.02 0.16 ± 0.02** −2.09 ± 0.02a 2.14 ± 0.05 1.53 ± 0.04** −0.61 ± 0.02c 2.23 ± 0.06 1.03 ± 0.07** −1.20 ± 0.06b

SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder; PE, phycoerythrin; PC, phycocyanin; APC, allophycocyanin; Chl-a, chlorophyll-a.

Different lowercase letters indicate significant differences among treatments for each pigment content. Values are presented as mean ± standard deviation (n = 15). Significant difference (*p < 0.05) and highly significant difference (**p < 0.01) between start and end of each treatment.

Table 2

Pigment contents of Pyropia yezoensis with different treatments under cold stress

Pigment content (mg g−1) Control SJEP AMPEP



Start End End-Start Start End End-Start Start End End-Start
PE 9.22 ± 0.14 7.20 ± 0.13** −2.02 ± 0.07a 9.02 ± 0.20 7.48 ± 0.13** −1.54 ± 0.08c 9.21 ± 0.09 7.39 ± 0.13** −1.82 ± 0.08b
PC 6.13 ± 0.03 4.76 ± 0.05** −1.37 ± 0.06a 6.43 ± 0.12 6.16 ± 0.06** −0.27 ± 0.07c 6.28 ± 0.05 5.13 ± 0.36** −1.15 ± 0.06b
APC 6.89 ± 0.11 8.59 ± 0.16** 1.70 ± 0.05a 7.09 ± 0.11 7.54 ± 0.12** 0.45 ± 0.03c 7.04 ± 0.11 7.76 ± 0.09** 0.72 ± 0.02b
Chl-a 1.51 ± 0.04 1.03 ± 0.07** −0.48 ± 0.02a 1.62 ± 0.27 1.41 ± 0.07** −0.21 ± 0.02b 1.42 ± 0.07 1.15 ± 0.08** −0.27 ± 0.06b

SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder; PE, phycoerythrin; PC, phycocyanin; APC, allophycocyanin; Chl-a, chlorophyll-a.

Different lowercase letters indicate significant differences among treatments for each pigment content. Values are presented as mean ± standard deviation (n = 15). Significant difference (*p < 0.05) and highly significant difference (**p < 0.01) between the start and end of each treatment.

Table 3

Contents of main bioactive substances in seaweed extracts of SJEP and AMPEP (μg g−1)

Polysaccharide Phenol Chl-a Carotenoid
SJEP 27.31 ± 0.21** 3.68 ± 0.09** 32.71 ± 0.28** 9.44 ± 0.07**
AMPEP 18.07 ± 0.19 1.87 ± 0.03** 21.93 ± 0.17** 24.73 ± 0.16**

SJEP, Saccharina japonica extract powder; AMPEP, Ascophyllum marine plant extract powder.

Values are presented as mean ± standard deviation (n = 3). Highly significant difference (**p < 0.01) between SJEP and AMPEP.