Evaluating nuclear (18S, ITS, and 28S) and chloroplast (psbB, psbC, rbcL, and tufA) genes of the green algae Monoraphidium (Sphaeropleales, Chlorophyta) for DNA barcoding

Article information

Algae. 2025;40(2):103-115
Publication date (electronic) : 2025 June 15
doi : https://doi.org/10.4490/algae.2025.40.4.15
1Department of Life Science, Sangmyung University, Seoul 03016, Korea
2Department of Life Science, Kyonggi University, Suwon 16227, Korea
*Corresponding Author: E-mail: kijs@smu.ac.kr, Tel: +82-2-2287-5449, Fax: +82-2-2287-0070
Received 2024 November 12; Accepted 2025 April 15.

Abstract

The genus Monoraphidium is a green microalgae distributed globally in freshwater ecosystems, and it is difficult to classify morphologically. Molecular genetic markers have been used for their taxonomy, although they have not been thoroughly evaluated. Here, we investigated three nuclear rRNA molecules (18S, internal transcribed spacer [ITS] + 5.8S, and 28S) and four chloroplast genes (psbB, psbC, rbcL, and tufA) using 16 Monoraphidium strains consisting of 9 species. Upon comparisons of genetic diversity and marker performance evaluation, we found that ITS was the best marker for Monoraphidium to discriminate each species, followed by tufA. The taxonomic discrimination power of the ITS was supported by the neighbor-joining tree. In addition, a secondary structure of ITS2 combined with compensatory base changes showed the distinct differences among individual species of Monoraphidium. These suggest that ITS may be the best marker for species differentiation of the coccoid green algae Monoraphidium.

INTRODUCTION

The green microalgae Monoraphidium (Selenastraceae, Sphaeropleales) is distributed in freshwater ecosystems universally (Krienitz and Bock 2012). It was established by Komárková-Legnerová in 1969, being created by revising the vaguely defined genus Ankistrodesmus Corda 1838 according to the morphological features (Komárek 1974, Heynig and Krienitz 1982). In the level of species, Monoraphidium species were characterized by elongated shapes ranging from fusiform to straight, spiral to thin crescent-shaped without mucilage. In addition, the presence of one or no pyrenoids and autospores was also considered unique morphological characters (Komárek 1974). Monoraphidium species have different morphologies; however, some structural characteristics were difficult to weigh (Krienitz et al. 2001). The limitations of morphological analysis have been resolved with molecular approaches that have been used as a statistical tool to show objective differences. Monoraphidium has been investigated primarily using 18S rRNA (Krienitz et al. 2001, Fawley et al. 2002, 2006).

The molecular method was considered a quick and easy way to identify diversity, and thus it has been utilized in industry. Strains of the Selenastraceae, especially Monoraphidium, were potential candidates for biodiesel and biomass production based on their high-value compounds, good growth performance, and lipid accumulation (Holbrook et al. 2014, Yee 2016, Lin et al. 2018). As many strains are used, accurate species identification has become critical to obtain maximum yields of biomass, providing different requirements: nutrient uptake, culture conditions, and lipid extraction techniques. In the case of Monoraphidium, the taxonomic positions of strains have been investigated with both morphological features using light microscopy (LM) and molecular analysis using 18S ribosomal DNA sequences (Holbrook et al. 2014, Lin et al. 2018, 2019, Vimali et al. 2022). Despite extensive research, many Monoraphidium strains remain unidentified at the species level. Identifying effective genetic markers for species differentiation is essential, and DNA barcoding represents a promising approach for resolving taxonomic ambiguities in Monoraphidium.

DNA barcoding is a molecular method that provides an efficient way for discovering, describing, and understanding biodiversity, and it is generally using DNA barcodes (Hebert and Barrett 2005, Hajibabaei et al. 2007, Bandyopadhyaya et al. 2013, Kress et al. 2015). Several regions of DNA have been utilized to provide adequate species identification, for example, cytochrome c oxidase subunit I (COI) in animals, rbcL and matK in land plants, and nuclear internal transcribed spacer (ITS) in fungi (Hebert et al. 2003, 2010, Hebert and Barrett 2005, CBOL Plant Working Group et al. 2009). Microalgae have different DNA barcodes depending on their phylum (e.g., diatoms, dinoflagellates), and some regions have been studied. For green algae, for example, several genes have been proposed, such as rbcL, ITS, and tufA (Hall et al. 2010, Saunders and Kucera 2010, Vieira et al. 2016). However, the efficiency of DNA barcodes can vary by taxon (Evans and Paulay 2012), and thus, it is necessary to investigate and validate which barcode is most suitable for the subcategory. In the case of Monoraphidium, despite its industrial importance and taxonomic complexity, the most appropriate barcode has not yet been compared clearly.

In the present study, we evaluated seven potential gene markers (three nuclear and four chloroplast DNA sequences) for DNA barcoding of the green algae Monoraphidium. We mainly calculated the efficiency of individual barcodes through their ability to discriminate species, differences in nucleotides, and contrast of genetic variation within and among species. Upon comparing several criteria, we selected the best marker for Monoraphidium and verified its performance.

MATERIALS AND METHODS

Sample collection, isolation, and culturing

Freshwater samples were collected from various areas in Korea in 2018 and 2019 (Table 1). A single cell was isolated using the Pasteur pipette (L = 230 mm; Witeg, Wertheim, Germany) under an inverted microscope KI450 (Korea Lab Tech, Seongnam, Korea). For culture, single cells were plated into 96-well plates prefilled with 200 μL URO medium and then incubated for one or two weeks. With increasing cell density, we gradually transferred it to the 24-well plate and 50-mL cell culture flask (SPL, Pocheon, Korea). During cultivation, cells were under the 12 h : 12 h light and dark cycles, ~65 μmol photons m−2 s−1, and 16°C temperature.

Sampling location and morphology comparisons of Monoraphidium species used in this study

DNA extraction, amplification, and assembly

The strains were harvested with a 0.2 μm pore-sized membrane filter (Millipore, Billerica, MA, USA) and treated with 800 μL cetyltrimethylammonium bromide (CTAB) buffer (100 mM Tris-HCl pH 8.0, 100 mM Na 2 EDTA, 100 mM sodium phosphate pH 8.0, 1.5 M NaCl, 1% CTAB). The sample was stored at −20°C until further experiment, and total genomic DNA was extracted following the CTAB method (Richards et al. 1994).

DNA barcoding loci were amplified with polymerase chain reaction (PCR) with each primer set (Table 2). The 20 μL PCR reaction mixture was composed of 12.8 μL sterile distilled water, 2 μL 10× Ex PCR buffer (Takara Shuzo, Kyoto, Japan), 2 μL dNTP mix (4 mM each), 1 μL of each primer (10 pmol), 0.2 μL Ex Taq polymerase (2.5 U), and 1 μL of template. The PCR performing conditions for nuclear regions were as follows: 94°C for 3 min; 40 cycles of 94°C for 30 s, 61°C for 40 s, and 72°C for 3 min; and 72°C for 10 min. For chloroplast regions, the PCR performing conditions were the same, except for the annealing temperature (61°C→55°C). The PCR product was confirmed with 1.5% agarose gel (Condalab, Madrid, Spain) stained with Midori Green under ultraviolet light. PCR products were purified with a QIAquick PCR Purification kit (Qiagen GmbH, Hilden, Germany).

List of primers for PCR and sequencing of nuclear rDNA and chloroplast genes of Monoraphidium

DNA was sequenced by the Sanger sequencing method with the ABI3730 DNA sequencer (Applied Biosystems, Foster City, CA, USA). The obtained DNA fragments were assembled and edited with Sequencher ver. 5.1 (Gene Codes Cor., Ann Arbor, MI, USA).

Species identification

Microscopic morphological identification was performed according to Komárková-Legnerová (1969), Hindák (1984), and Nygaard (1977). Morphology of the isolated strain were observed with a LM (Axioskop; Carl Zeiss, Oberkochen, Germany) under 400–1,000× magnification. Further identification was made by comparing DNA sequences in the National Center for Biotechnology Information (NCBI) database.

DNA sequence characterization and divergence analysis

Basic Local Alignment Search Tool (BLAST) searches were performed to validate the sequences of rRNA molecules (18S, ITS + 5.8S, and 28S) and chloroplast genes (psbB, psbC, rbcL, and tufA) obtained from the present study. We aligned the sequences using MAFFT (Katoh and Standley 2013) and removed ambiguous regions using the Gblocks server (http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=gblocks).

A phylogenetic tree of representative species was constructed using the neighbor-joining (NJ) algorithm (Saitou and Nei 1987) with the maximum composite likelihood model. The NJ topology was evaluated with 1,000 replicates, and the bootstrap proportions lower than 50 were discarded. Additionally, pairwise genetic distances were computed using the Kimura 2-parameter (K2P) model (Kimura 1980) with MEGA ver. 11 (Tamura et al. 2021). The genetic K2P distances were also utilized to define the barcode gaps at the species level, comparing the maximum intraspecific genetic distance with the minimum distance to the nearest neighbor.

Phylogenetic analysis and internal transcribed spacer 2 secondary structure modeling

NJ analysis was conducted with a selected model in MEGA ver. 11 (Tamura et al. 2021). The sequences of other Monoraphidium strains or species were obtained from the NCBI. The visualized tree was edited in Adobe Illustrator CC (Adobe Systems, San Jose, CA, USA).

In particular, ITS2 sequences were annotated using the Hidden Markov Models-based annotation tool present in the ITS2 database V (Ankenbrand et al. 2015). The tree construction was processed the same way as described above.

The secondary structures of the rRNA ITS2 region were modeled using the Fold Web Server (https://rna.urmc.rochester.edu/RNAstructureWeb/Servers/Fold/Fold.html). It folded the nucleic acids into lowest free energy conformation. The construction of the model considered the presence of the pyrimidine-pyrimidine unpaired section at the ninth position in the second helix (Caisová et al. 2013) and the length and nucleotide composition of the spacers in the core of the model delimiting the helix boundaries (Schultz et al. 2005). The resulting secondary structures were visualized in PseudoViewer ver. 2.5 (Byun and Han 2009).

In addition, ITS2 sequences were aligned with the ClustalW algorithm (Thompson et al. 1994), and the sequence-structure alignment was performed in 4SALE ver. 1.7.1 (Seibel et al. 2006). Species delimitation according to ITS2 secondary structure within Monoraphidium species was defined using compensatory base changes (CBCs) according to Coleman (2000) and Müller et al. (2007). The ITS2 structure was further edited in Adobe Illustrator CC (Adobe Systems) to indicate the CBCs on the secondary structure of ITS2 of the strain.

RESULTS

Identification and genetic diversity among Monoraphidium species

In this study, we examined morphological key characteristics (e.g., cell length, width, shape, and tip shape) of 16 strains, and identified them as nine distinct Monoraphidium species (Table 1). The DNA sequences of nuclear rRNA (18S, ITS, and 28S) and chloroplast genes (psbB, psbC, rbcL, and tufA) were separately obtained from 16 Monoraphidium strains (Table 3). The average lengths of the seven gene sequences were 2,003 (18S), 700 (ITS), 1,339 (28S), 1,447 (rbcL), 1,277 (psbB), 1,190 (psbC), and 719 (tufA), respectively. Introns were found in three regions, 18S and 28S nuclear RNAs, and rbcL in chloroplast genes. Eight of the 16 individuals contained at least one and up to three introns within the genetic regions. Intron lengths ranged from about 400 bp to about 1.7 kb.

List of sequences utilized for the DNA barcode evaluation of Monoraphidium with GenBank accession numbers

In addition, a total of 10 species, including 9 Monoraphidium species and the outgroup Kirchneriella aperta, were used for phylogenetic analysis to compare the degree of resolution. Each phylogenetic tree was resized to fit a shared distance scale bar, maintaining the original rate of length among branches (Fig. 1A & B). The branch lengths of 18S and 28S were shorter than other trees, and tufA was the longest. The branch lengths of all the trees showed distinct branches for each species, except Monoraphidium minutum and Monoraphidium nanum in psbC.

Fig. 1

Distance-based phylogenetic trees of 9 selected representative Monoraphidium species using nuclear (18S, internal transcribed spacer [ITS], and 28S) (A) and chloroplast (psbB, psbC, rbcL, and tufA) (B) genes with an outgroup, Kirchneriella aperta. All trees were constructed using the algorithm of the neighbor-joining-maximum composite likelihood model in MEGA 11. The scale bar is shared for all trees and shows the genetic distance. Kape, Kirchneriella aperta; Mcnt, Monoraphidium contortum; Mdyb, Monoraphidium dybowskii; Mint, Monoraphidium intermedium; Mkom, Monoraphidium komarkovae; Mmin, Monoraphidium minutum; Mnan, Monoraphidium nanum; Mpus, Monoraphidium pusillum; Msax, Monoraphidium saxatile; Msub, Monoraphidium subclavatum.

The p-distances of each sequence were visualized in bar graphs (Fig. 2). Bar heights of sequences were almost matched to the length of branches. Overall, nuclear regions showed lower nucleotide divergence than chloroplast genes; however, the ITS region was as variable as much as chloroplast genes. The least diverse region was 18S, and the most diverse region was tufA. The average of p-distances was 7.78 for seven selected sequences.

Fig. 2

Nucleotide divergences of selected seven genes: 18S, internal transcribed spacer (ITS), 28S, psbB, psbC, rbcL, and tufA. The proportion of different nucleotide sites of two sequences was calculated with the Kimura-two parameter model in MEGA 11. Representative strains of nine species were used for analysis. Bar heights are means of % p-distances, and each bar is shown with a standard error. The dotted line indicates the average % p-distance (7.78) for seven selected genes.

Marker performance evaluation

The pairwise distance distributions were analyzed with a box plot graph comparing the interspecific and intraspecific distances (Fig. 3). The box plots represent medians and interquartile ranges for intraspecific and interspecific K2P genetic distances of seven DNA regions.

Fig. 3

Pairwise distance distributions of the seven genes using a boxplot. The bottom and top of the box represent the 25th and 75th percentiles, respectively, and the bold horizontal line indicates the median. Sequences from 16 strains (9 species) from the present study were utilized. For each gene, intraspecific (left) and interspecific (right) distances are shown. Markers were labeled as ‘Good’ (green), ‘Intermediate’ (orange), or ‘Poor’ (red) based on the presence of barcode gaps. Barcode gaps were assessed by considering the maximum intraspecific and minimum interspecific limits specified by whiskers. ITS, internal transcribed spacer.

No DNA barcode region was classified as ‘poor’, while two regions, 28S and psbC, were evaluated as ‘intermediate’ grade. Five regions—18S, ITS, psbB, rbcL, and tufA—were assessed as ‘good’ DNA barcodes, showing clear interspecies gaps. In addition, we evaluated the regions using several criteria, such as PCR success percentage on the first try, the presence of introns, and sequence length used in the analysis (Table 4). PCR success percentage was higher in nuclear regions than in chloroplast genes. In particular, one sequence of psbB (M. nanum C-253) was not amplified and failed to obtain the sequence. Another factor, the introns, was detected at both nuclear (18S and 28S) and chloroplast (rbcL) genes. In 18S, Monoraphidium komarkovae Ga022, M. minutum Ga027, M. nanum Ga031, and Monoraphidium subclavatum Ga035 included intron regions, and in 28S, Monoraphidium dybowskii Ga011, M. dybowskii Ga012, M. minutum Ga027, M. nanum Ga031, and M. nanum C-253 included intron regions. In rbcL genes, introns were detected from Monoraphidium contortum Ga008, M. dybowskii Ga012, and M. nanum Ga031. The average length of rbcL without introns was calculated to be about 1,160 bp, but the rbcL length of M. nanum Ga031 was more than 4,000 bp. Because of its long length, partial introns were not fully determined, and the incompletely determined region was represented by multiple Ns representing a blank space and an estimated length. We also calculated the sequence length and selected the three shortest regions (ITS, psbC, and tufA). Only ITS met all the criteria required for DNA barcode evaluation, and the second-best marker was tufA.

A summary of DNA barcode performances of seven markers from Monoraphidium

Marker performance verification

We constructed an NJ phylogenetic tree for 35 Monoraphidium strains using the ITS marker with the outgroup K. aperta (Fig. 4). It showed distinct clades for each species and close distances between the same species. Clades of each species were supported with bootstrap values above 50 except M. minutum Ga027 and M. contortum Ga008. On the other hand, most of the bootstrap values supporting the relationships between species were lower than 50. It suggested that ITS regions are suitable for species distinction but not for phylogenetic analysis.

Fig. 4

Neighbor-joining tree of Monoraphidium (35 strains) using internal transcribed spacer markers with Kirchneriella aperta as an outgroup. This tree was constructed with the Kimura 2-parameter model in MEGA 11. The strength of the internal branches was tested with 1,000 bootstrap replications. Bootstrap values below 50 were discarded.

In addition to the ITS phylogenetic tree, the ITS2 secondary structure combined with CBCs was constructed. The CBCs mapped on ITS2 are a tool to distinguish species, proposed by Coleman (2000) and Müller et al. (2007). According to Coleman (2000), even a single CBC in the conserved regions of Helix II and Helix III could discriminate two species. Müller et al. (2007) proposed that any CBC in the entire ITS2 could be enough to distinguish the species. Our study showed the representative ITS2 structure of M. dybowskii GA011 and marked the location of CBCs of each species (Fig. 5A). Secondary structures of each strain were constructed, and detailed nucleotide divergence within branches is shown in Fig. 5B–F.

Fig. 5

A predicted secondary structure (A) of the nuclear internal transcribed spacer 2 (ITS2) of the strain Ga011 (Monoraphidium dybowskii, GenBank accession No. PP711301). Black boxes on the branches indicate the positions of compensatory base changes (CBCs) between M. dybowskii and eight other species. The assigned numbers of the species are shown on the left side of the structure, and the presence of CBCs is indicated along with the species number. Additional secondary structures of each helix (B, Helix1a; C, Helix1b; D, Helix2; E, Helix3; and F, Helix4, respectively) in the ITS2 rRNA gene of nine species of Monoraphidium. Species are indicated by their abbreviated names as described in Table 2.

DISCUSSION

Importance of DNA barcoding in Monoraphidium

Monoraphidium was once classified into the family Chlorellaceae (Chlorococcales) and the Ankistrodesmaceae (Chlorellales) because of its coccoid form (Hindák 1977, Komárek and Fott 1983). It is now classified under the family Selenastraceae, with genera differentiated primarily based on morphological characteristics. These include the shape of cells and colonies, the arrangement of autospores inside the mother cells, the development of mucilage and encrustations on the cell wall, and the presence, number, and type of pyrenoids (Komárek and Fott 1983, Marvan et al. 1984). Several genera, such as Selenastrum, Ankistrodesmus, and Chlorolobion, differ from each other by only one of the above characters (Krienitz et al. 2001). However, Monoraphidium has similar morphologies with Kirchneriella, Ankistrodesmus, and Chlorolobion, which have the same features in the arrangement of autospores, pyrenoid structures, and the presence of starch envelope, respectively (Krienitz et al. 2001). Within the genus Monoraphidium, species are categorized according to colony formation, length and width, the degree of curvation, shape of the ends, shape, and existence of chloroplast and pyrenoid, the position of the nucleus, and characteristics of autospores. These are distinguishable under LM: however, some Monoraphidium species have almost identical morphology in size, cell shape, and the structural features of cell walls and pyrenoids (Krienitz et al. 2001).

As mentioned above, Monoraphidium poses significant difficulties in distinguishing among species due to their limited morphological variability. This challenge suggests the importance of DNA barcoding as a molecular tool that uses specific genetic markers for accurate species identification. Recent study has shown that even with standard DNA barcoding markers like 18S, species-level identification can be problematic (Zou et al. 2016). To solve this, our study takes a comprehensive approach by evaluating seven genetic markers—18S, ITS, 28S, psbB, psbC, rbcL, and tufA—all derived from the same isolates. This method ensures data consistency, allowing us to directly compare the performance of each marker and minimize any biases that might arise from using sequences from different strains. With these comparisons, we could identify the most effective marker for distinguishing among closely related Monoraphidium species, contributing to more effective species identification.

The effectiveness of DNA barcoding for species identification relies heavily on the performance of genetic markers, which must be evaluated using standardized criteria to ensure accuracy and reliability. For example, barcode gap analysis suggested as critical for assessing a marker’s ability to distinguish individual species (Badotti et al. 2017). Barcode gap analysis examines whether there is a distinct separation between intraspecific and interspecific genetic distances. This criterion is crucial because it offers a visual and intuitive way to assess whether a marker can consistently separate species (Fig. 3). A clear gap reduces the risk of misidentification, which is particularly important in groups with closely related or cryptic microalgal species. By highlighting cases where overlap occurs, barcode gap analysis ensures researchers can identify when a marker may fail and consider alternatives. In the present study, we applied these criteria to evaluate seven gene markers for the green algal genus Monoraphidium, and succeeded to identify the most effective marker for species delineation.

Features of nuclear and chloroplast genes used in DNA barcoding

To overcome the limitation of morphological characters, molecular analyses using 18S rRNA sequences have been investigated. The results verified the taxonomical lineage of Monoraphidium in the family Selenastraceae, however, revealed the unrelativeness between morphological criterion and genetic analyses and polyphyletic lineages (Krienitz et al. 2001, Fawley et al. 2006). Although 18S is one of the most phylogenetically typical and preferred markers, the phylogeny of Monoraphidium does not appear to be well described. In addition, these results show that one marker cannot perform the same function for all taxa.

The nuclear and chloroplast sequences are the most broadly used DNA barcodes for algae (Saunders and McDevit 2012). The 18S rRNA gene has been used widely for DNA barcoding, but it does not have sufficient resolution at the species level and even shows the lowest divergence among seven markers within Monoraphidium (Figs 1 & 2). Alternatively, the nuclear 28S rRNA D2/D3 region is considered one of the primary barcodes for green algae (Kress and Erickson 2007, 2012, Minicante et al. 2014). However, the 28S regions of the Monoraphidium were classified as ‘intermediate’ due to the absence of barcode gaps and suggested to be unsuitable (Fig. 3). More variable markers, such as chloroplast genes or the ITS regions, were suitable for species delineation (Schultz and Wolf 2009).

On the other hand, chloroplast genes psbB and psbC contribute to light harvesting in photosynthesis in living cells and have been evaluated as DNA barcodes in plants and green algae (Cameron and Carmen Molina 2006, Shetty et al. 2021). In Monoraphidium, both genes exhibited challenges, including low PCR success rates, sequence degradation, presence of introns, and lack of clear barcode gaps. In addition, the rbcL is one of the standard DNA barcodes established among plant groups (CBOL Plant Working Group et al. 2009). However, green algae frequently retain introns; thus, introns have been found in rbcL of some green algae (Hanyuda et al. 2000), including Monoraphidium. Such introns can negatively impact the universality of barcode markers, as they hinder the amplification and sequencing of large fragments with a single bidirectional read. Lastly, the plastid elongation factor tufA is the primary barcode for green algae, and it is known to lack introns for the variety of green taxa (Famà et al. 2002, Verbruggen et al. 2009). Monoraphidium also showed no introns of tufA from all tested strains. It also showed a barcoding gap and was classified as ‘good’, but had lower PCR success rates on the first try than nuclear ITS. Our results suggest that the ITS region showed the best performances as DNA barcodes for Monoraphidium and the tufA may be second.

Performance of ITS for Sphaeropleales

The ITS region is considered one of the most useful markers within the Sphaeropleales. Especially, the ITS2 region, a part of the ITS, was recognized by Coleman and Müller for its ability to distinguish species based on secondary structure and is still used today for discovering new species. This finding further supports the suitability of ITS as a DNA barcode. Beyond Selenastraceae, which includes Monoraphidium (Garcia da Silva et al. 2017, Liu et al. 2024), ITS regions are widely used for species distinction across various families, such as Hydrodictyaceae (McManus and Lewis 2005), Mychonastaceae (Krienitz et al. 2011, Martynenko et al. 2022), and Scenedesmaceae (Nguyen et al. 2023). These findings and our results suggest that the species discrimination capabilities of ITS sequences may be applicable across the Sphaeropleales. On the other hand, other DNA barcoding studies in green algae suggested tufA as a suitable marker (Saunders and Kucera 2010, Vieira et al. 2016). Moreover, Vieira et al. (2016) also reported that the ITS region showed a low amplification and sequencing success rate for freshwater Chlorophyceae. These conflicting results imply that more DNA barcode studies for green algae are needed across various levels of taxonomy.

Our current understanding suggests that Monoraphidium is polyphyletic, sharing morphological similarities with genera like Ankistrodesmus within Selenastraceae. Consequently, it is essential to identify barcodes capable of discriminating between these genera. Sequencing the ITS region of Ankistrodesmus will be necessary to confirm its potential for species differentiation in future studies.

In the present study, we assessed several promising gene markers for the species identification of the genus Monoraphidium and selected the ITS region as the most suitable marker. Its efficiency and capability were evaluated through genetic diversity and pairwise distance comparison. Moreover, these were verified by constructing an NJ tree and analyzing the secondary structure of ITS2 with CBCs. The tree showed distinctly separated groups of species, and the structure indicates nucleotide variations among species. In contrast, tufA, another promising marker among green algae, was also evaluated but ranked second for Monoraphidium. With these results, we can conclude that the ITS may be the best marker for Monoraphidium and a promising marker among green algae. Furthermore, we suggest the ITS region to be an effective marker for the order Sphaeropleales (Chlorophyta), and this study could be a basis for future DNA barcoding studies for green algae.

Notes

ACKNOWLEDGEMENTS

We thank Dr. BL Muhammad for valuable comments to the early version of our manuscript. This work was supported by Korea Environment Industry & Technology Institute (KEITI) through Aquatic Ecosystem Conservation Research Program funded by Korea Ministry of Environment (MOE) (2022003050002 or RS-2022-KE002119211530) and by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (RS-2024-00354842).

CONFLICTS OF INTEREST

The authors declare that they have no potential conflicts of interest.

Abbreviations

CBC

compensatory base change

CTAB

cetyltrimethylammonium bromide

ITS

internal transcribed spacer

K2P

Kimura 2-parameter

LM

light microscopy

NCBI

National Center for Biotechnology Information

NJ

neighbor-joining

PCR

polymerase chain reaction

References

Ankenbrand M. J., Keller A., Wolf M., Schultz J., Förster F.. 2015;ITS2 database V: twice as much. Mol. Biol. Evol 32:3030–3032. doi.org/10.1093/molbev/msv174.
Badotti F., de Oliveira F. S., Garcia C. F., et al. 2017;Effectiveness of ITS and sub-regions as DNA barcode markers for the identification of Basidiomycota (Fungi). BMC Microbiol 17:42. doi.org/10.1186/s12866-017-0958-x.
Bandyopadhyaya S., Ramakrishnan M., Kulkarni S., Rajanna L.. 2013;DNA barcoding and its applications: a critical review. CMRIMS J. Res. Dev 1:77–81.
Byun Y., Han K.. 2009;PseudoViewer3: generating planar drawings of large-scale RNA structures with pseudoknots. Bioinformatics 25:1435–1437. doi.org/10.1093/bioinformatics/btp252.
Caisová L., Marin B., Melkonian M.. 2013;A consensus secondary structure of ITS2 in the Chlorophyta identified by phylogenetic reconstruction. Protist 164:482–496. doi.org/10.1016/j.protis.2013.04.005.
Cameron K. M., Carmen Molina M.. 2006;Photosystem II gene sequences of psbB and psbC clarify the phylogenetic position of Vanilla (Vanilloideae, Orchidaceae). Cladistics 22:239–248. doi.org/10.1111/j.1096-0031.2006.00102.x.
CBOL Plant Working Group, Hollingsworth P. M., Forrest L. L., et al. 2009;A DNA barcode for land plants. Proc. Natl. Acad. Sci. U. S. A 106:12794–12797. doi.org/10.1073/pnas.0905845106.
Coleman A. W.. 2000;The significance of a coincidence between evolutionary landmarks found in mating affinity and a DNA sequence. Protist 151:1–9. doi.org/10.1078/1434-4610-00002.
Evans N., Paulay G.. 2012;DNA barcoding methods for invertebrates. Methods Mol. Biol 858:47–77. doi.org/10.1007/978-1-61779-591-6_4.
Famà P., Wysor B., Kooistra W. H. C. F., Zuccarello G. C.. 2002;Molecular phylogeny of the genus Caulerpa (Caulerpales, Chlorophyta) inferred from chloroplast tufA gene. J. Phycol 38:1040–1050. doi.org/10.1046/j.1529-8817.2002.t01-1-01237.x.
Fawley M. W., Dean M. L., Dimmer S. K., Fawley K. P.. 2006;Evaluating the morphospecies concept in the Selenastraceae (Chlorophyceae, Chlorophyta). J. Phycol 42:142–154. doi.org/10.1111/j.1529-8817.2006.00169.x.
Fawley M. W., Fawley K. P., Dean M. L.. 2002;Assessing the biodiversity of Monoraphidium using 18S rDNA sequences. J. Phycol 38:9. doi.org/10.1046/j.1529-8817.38.s1.25.x.
Garcia da Silva T., Bock C., Sant’Anna C. L., Bagatini I. L., Wodniok S., Vieira A. A. H.. 2017;Selenastraceae (Sphaeropleales, Chlorophyceae): rbcL, 18S rDNA and ITS-2 secondary structure enlightens traditional taxonomy, with description of two new genera, Messastrum gen. nov. and Curvastrum gen. nov. Fottea 17:1–19. doi.org/10.5507/fot.2016.010.
Hajibabaei M., Singer G. A. C., Clare E. L., Hebert P. D. N.. 2007;Design and applicability of DNA arrays and DNA barcodes in biodiversity monitoring. BMC Biol 5:24. doi.org/10.1186/1741-7007-5-24.
Hall J. D., Fučíková K., Lo C., Lewis L. A., Karol K. G.. 2010;An assessment of proposed DNA barcodes in freshwater green algae. Cryptogam. Algol 31:529–555.
Hanyuda T., Arai S., Ueda K.. 2000;Variability in the rbcL introns of Caulerpalean algae (Chlorophyta, Ulvophyceae). J. Plant Res 113:403–413. doi.org/10.1007/PL00013948.
Hebert P. D. N., Barrett R. D. H.. 2005;Reply to the comment by L. Prendini on “Identifying spiders through DNA barcodes”. Can. J. Zool 83:505–506. doi.org/10.1139/z05-026.
Hebert P. D. N., Cywinska A., Ball S. L., DeWaard J. R.. 2003;Biological identifications through DNA barcodes. Proc. Biol. Sci 270:313–321. doi.org/10.1098/rspb.2002.2218.
Hebert P. D. N., de Waard J. R., Landry J.-F.. 2010;DNA barcodes for 1/1000 of the animal kingdom. Biol. Lett 6:359–362. doi.org/10.1098/rsbl.2009.0848.
Heynig H., Krienitz L.. 1982;Monoraphidium neglectum n. sp. and some remarks on the genera Monoraphidium, Chlorolobion and Keratococcus (Chlorococcales). Arch. Protistenkd 125:335–344. doi.org/10.1016/S0003-9365(82)80032-8.
Hindák F.. 1977;Studies on the chlorococcal algae (Chlorophyceae) I. Biol. Práce 28:1–263.
Hindák F.. 1984;Studies on the chlorococcal algae (Chlorophyceae) III. Biol. Práce 30:1–312.
Holbrook G. P., Davidson Z., Tatara R. A., Ziemer N. L., Rosentrater K. A., Grayburn W. S.. 2014;Use of the microalga Monoraphidium sp. grown in wastewater as a feedstock for biodiesel: cultivation and fuel characteristics. Appl. Energy 131:386–393. doi.org/10.1016/j.apenergy.2014.06.043.
Katoh K., Standley D. M.. 2013;MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol 30:772–780. doi.org/10.1093/molbev/mst010.
Kimura M.. 1980;A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol 16:111–120. doi.org/10.1007/BF01731581.
Komárek J.. 1974;Monoraphidium flexuosum, a new chlorococcal alga from the lakes of northwestern Ontario (Canada). Preslia 46:118–122.
Komárek J., Fott B.. 1983. Chlorophyceae (Grünalgen), Ordnung Chlorococcales. In : Huber-Pestalozzi G., ed. Das Phytoplankton des Süsswassers, Die Binnengewässer 16, 7/1 Schweizerbart Verlag. Stuttgart: p. 1–1044.
Komárková-Legnerová J.. 1969. The systematics and ontogenesis of the genera Ankistrodesmus Corda and Monoraphidium gen. nov. In : Fott B., ed. Studies in Phycology Academia Publishing House of the Czechosolvak Academy of Sciences. Prague: p. 75–144.
Kress W. J., Erickson D. L.. 2007;A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region. PLoS ONE 2:e508. doi.org/10.1371/journal.pone.0000508.
Kress W. J., Erickson D. L.. 2012. DNA barcodes: methods and protocols. In : Kress W. J., Erickson D. L., eds. DNA Barcodes: Methods and Protocols Humana Press. Totowa, NJ: p. 3–8.
Kress W. J., García-Robledo C., Uriarte M., Erickson D. L.. 2015;DNA barcodes for ecology, evolution, and conservation. Trends Ecol. Evol 30:25–35. doi.org/10.1016/j.tree.2014.10.008.
Krienitz L., Bock C.. 2012;Present state of the systematics of planktonic coccoid green algae of inland waters. Hydrobiologia 698:295–326. doi.org/10.1007/s10750-012-1079-z.
Krienitz L., Bock C., Dadheech P. K., Pröschold T.. 2011;Taxonomic reassessment of the genus Mychonastes (Chlorophyceae, Chlorophyta) including the description of eight new species. Phycologia 50:89–106. doi.org/10.2216/10-15.1.
Krienitz L., Ustinova I., Friedl T., Huss V. A. R.. 2001;Traditional generic concepts versus 18S rRNA gene phylogeny in the green algal family Selenastraceae (Chlorophyceae, Chlorophyta). J. Phycol 37:852–865. doi.org/10.1046/j.1529-8817.2001.01004.x.
Lin Y., Ge J., Ling H., Zhang Y., Yan X., Ping W.. 2018;Isolation of a novel strain of Monoraphidium sp. and characterization of its potential for α-linolenic acid and biodiesel production. Bioresour. Technol 267:466–472. doi.org/10.1016/j.biortech.2018.07.081.
Lin Y., Ge J., Zhang Y., Ling H., Yan X., Ping W.. 2019;Monoraphidium sp. HDMA-20 is a new potential source of α-linolenic acid and eicosatetraenoic acid. Lipids Health Dis 18:56. doi.org/10.1186/s12944-019-0996-5.
Liu X., Ma N., Feng J., et al. 2024;Selenastrum densum sp. nov., a new member of the genus Selenastrum (Selenastraceae, Chlorophyceae, Chlorophyta). J. Oceanol. Limnol Advanced online publicationdoi.org/10.1007/s00343-024-4082-0.
Martynenko N., Gusev E., Kapustin D., Kulikovskiy M.. 2022;A new cryptic species of the genus Mychonastes (Chlorophyceae, Sphaeropleales). Plants 11:3363. doi.org/10.3390/plants11233363.
Marvan P., Komárek J., Comas A.. 1984;Weighting and scaling of features in numerical evaluation of coccal green algae (genera of the Selenastraceae). Arch. Hydrobiol. Suppl 67:363–399. doi.org/10.1127/algol_stud/67/1984/363.
McManus H. A., Lewis L. A.. 2005;Molecular phylogenetics, morphological variation and colony-form evolution in the family Hydrodictyaceae (Sphaeropleales, Chlorophyta). Phycologia 44:582–595. doi.org/10.2216/0031-8884(2005)44[582:MPMVAC]2.0.CO;2.
Minicante S. A., Genovese G., Morabito M.. 2014;Two new alien macroalgae identified by the DNA barcoding. Biol. Mar. Mediterr 21:70–72.
Müller T., Philippi N., Dandekar T., Schultz J., Wolf M.. 2007;Distinguishing species. RNA 13:1469–1472. doi.org/10.1127/10.1261/rna.617107.
Nguyen M. L., Mai X. C., Chu N. H., Trinh D. M., Liu C.-L., Shen C.-R.. 2023;DNA signaturing derived from the internal transcribed spacer 2 (ITS2): a novel tool for identifying Desmodesmus species (Scenedesmaceae, Chlorophyta). Fottea 23:1–7. doi.org/10.5507/fot.2022.005.
Nygaard G.. 1977;New or interesting plankton algae: with a contribution on their ecology. Biol. Skr 21:1–107.
Richards E., Reichardt M., Rogers S.. 1994;Preparation of genomic DNA from plant tissue. Curr. Protoc. Mol. Biol 2:Unit2.3. doi.org/10.1002/0471142727.mb0203s27.
Saitou N., Nei M.. 1987;The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol 4:406–425. doi.org/10.1093/oxfordjournals.molbev.a040454.
Saunders G. W., Kucera H.. 2010;An evaluation of rbcL, tufA, UPA, LSU and ITS as DNA barcode markers for the marine green macroalgae. Cryptogam. Algol 31:487–528.
Saunders G. W., McDevit D. C.. 2012;Methods for DNA barcoding photosynthetic protists emphasizing the macroalgae and diatoms. Methods Mol. Biol 858:207–222. doi.org/10.1007/978-1-61779-591-6_10.
Schultz J., Maisel S., Gerlach D., Müller T., Wolf M.. 2005;A common core of secondary structure of the internal transcribed spacer 2 (ITS2) throughout the Eukaryota. RNA 11:361–364. doi.org/10.1261/rna.7204505.
Schultz J., Wolf M.. 2009;ITS2 sequence–structure analysis in phylogenetics: a how-to manual for molecular systematics. Mol. Phylogenet. Evol 52:520–523. doi.org/10.1016/j.ympev.2009.01.008.
Seibel P. N., Müller T., Dandekar T., Schultz J., Wolf M.. 2006;4SALE: a tool for synchronous RNA sequence and secondary structure alignment and editing. BMC Bioinformatics 7:498. doi.org/10.1186/1471-2105-7-498.
Shetty P., Farkas A., Pap B., et al. 2021;Comparative and phylogenomic analysis of nuclear and organelle genes in cryptic Coelastrella vacuolata MACC-549 green algae. Algal Res 58:102380. doi.org/10.1016/j.algal.2021.102380.
Tamura K., Stecher G., Kumar S.. 2021;MEGA11: molecular evolutionary genetics analysis version 11. Mol. Biol. Evol 38:3022–3027. doi.org/10.1093/molbev/msab120.
Thompson J. D., Higgins D. G., Gibson T. J.. 1994;CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi.org/10.1093/nar/22.22.4673.
Verbruggen H., Ashworth M., LoDuca S. T., et al. 2009;A multi-locus time-calibrated phylogeny of the siphonous green algae. Mol. Phylogenet. Evol 50:642–653. doi.org/10.1016/j.ympev.2008.12.018.
Vieira H. H., Bagatini I. L., Guinart C. M., Vieira A. A. H.. 2016;tufA gene as molecular marker for freshwater Chlorophyceae. Algae 31:155–165. doi.org/10.4490/algae.2016.31.4.14.
Vimali E., Sakthi Vignesh N., Kandasamy M., et al. 2022;Influence of food waste and graphene oxide manosheets on Monoraphidium sp. VV1 biomass and biodiesel production. Top. Catal Advanced online Publicationdoi.org/10.1007/s11244-022-01755-7.
Yee W.. 2016;Microalgae from the Selenastraceae as emerging candidates for biodiesel production: a mini review. World J. Microbiol. Biotechnol 32:64. doi.org/10.1007/s11274-016-2023-6.
Zou S., Fei C., Wang C., et al. 2016;How DNA barcoding can be more effective in microalgae identification: a case of cryptic diversity revelation in Scenedesmus (Chlorophyceae). Sci. Rep 6:36822. doi.org/10.1038/srep36822.

Article information Continued

Fig. 1

Distance-based phylogenetic trees of 9 selected representative Monoraphidium species using nuclear (18S, internal transcribed spacer [ITS], and 28S) (A) and chloroplast (psbB, psbC, rbcL, and tufA) (B) genes with an outgroup, Kirchneriella aperta. All trees were constructed using the algorithm of the neighbor-joining-maximum composite likelihood model in MEGA 11. The scale bar is shared for all trees and shows the genetic distance. Kape, Kirchneriella aperta; Mcnt, Monoraphidium contortum; Mdyb, Monoraphidium dybowskii; Mint, Monoraphidium intermedium; Mkom, Monoraphidium komarkovae; Mmin, Monoraphidium minutum; Mnan, Monoraphidium nanum; Mpus, Monoraphidium pusillum; Msax, Monoraphidium saxatile; Msub, Monoraphidium subclavatum.

Fig. 2

Nucleotide divergences of selected seven genes: 18S, internal transcribed spacer (ITS), 28S, psbB, psbC, rbcL, and tufA. The proportion of different nucleotide sites of two sequences was calculated with the Kimura-two parameter model in MEGA 11. Representative strains of nine species were used for analysis. Bar heights are means of % p-distances, and each bar is shown with a standard error. The dotted line indicates the average % p-distance (7.78) for seven selected genes.

Fig. 3

Pairwise distance distributions of the seven genes using a boxplot. The bottom and top of the box represent the 25th and 75th percentiles, respectively, and the bold horizontal line indicates the median. Sequences from 16 strains (9 species) from the present study were utilized. For each gene, intraspecific (left) and interspecific (right) distances are shown. Markers were labeled as ‘Good’ (green), ‘Intermediate’ (orange), or ‘Poor’ (red) based on the presence of barcode gaps. Barcode gaps were assessed by considering the maximum intraspecific and minimum interspecific limits specified by whiskers. ITS, internal transcribed spacer.

Fig. 4

Neighbor-joining tree of Monoraphidium (35 strains) using internal transcribed spacer markers with Kirchneriella aperta as an outgroup. This tree was constructed with the Kimura 2-parameter model in MEGA 11. The strength of the internal branches was tested with 1,000 bootstrap replications. Bootstrap values below 50 were discarded.

Fig. 5

A predicted secondary structure (A) of the nuclear internal transcribed spacer 2 (ITS2) of the strain Ga011 (Monoraphidium dybowskii, GenBank accession No. PP711301). Black boxes on the branches indicate the positions of compensatory base changes (CBCs) between M. dybowskii and eight other species. The assigned numbers of the species are shown on the left side of the structure, and the presence of CBCs is indicated along with the species number. Additional secondary structures of each helix (B, Helix1a; C, Helix1b; D, Helix2; E, Helix3; and F, Helix4, respectively) in the ITS2 rRNA gene of nine species of Monoraphidium. Species are indicated by their abbreviated names as described in Table 2.

Table 1

Sampling location and morphology comparisons of Monoraphidium species used in this study

Species Strain Collection site Length (μm) Width (μm) Cell shape Cell tips
M. contortum Ga008 37°16′48.6″ N, 126°59′16.6″ E 10–34.3 1.5–6 Strongly curved, sigmoid or spiral Tapered gradually
M. dybowskii Ga011 37°12′18.4″ N, 127°44′48.9″ E 12.8–18 1.5–3.7 Slightly convex with straight side Bluntly rounded
Ga012 37°16′43.6″ N, 127°40′53.3″ E 11.9–17.8 1.5–3.7
M. intermedium Ga016 37°16′48.6″ N, 126°59′16.6″ E 26–42 2–3.5 Fusiform Tapered gradually
M. komarkovae Ga022 36°44′00.8″ N, 128°39′42.9″ E 10–15 2–3 Straight or slightly curved Rounded
Ga013 33°30′31.9″ N, 126°43′03.5″ E 11–15 2–3
Ga021 36°19′57.5″ N, 129°22′40.7″ E 10–15 2–3
M. pusillum Ga024 37°23′33.0″ N, 127°05′28.9″ E 10–31 2–5 Straight or slightly curved fusiform, rarely lunate Rounded or gradually tapering
Ga025 37°11′48.4″ N, 126°58′30.5″ E 10–29 2–5
Ga032 37°16′48.6″ N, 126°59′16.6″ E 11–31 2–5
M. minutum Ga027 34°50′13.4″ N, 126°58′28.5″ E 5.5–12.4 2.3–5.4 Cylindrical, arcuate, or sigmoid Rounded
M. nanum Ga031 37°04′45.6″ N, 127°21′52.6″ E 2–5.5 1.3–2 Arcuate Broadly rounded
C-253 37°39′15.6″ N, 127°17′15.9″ E 2.2–5.3 1.5–2
M. saxatile Ga033 37°08′18.0″ N, 127°44′11.2″ E 25–37 2.5–4 Linear or arcuate Tapered gradually
Ga014 37°23′33.0″ N, 127°05′28.9″ E 24–37 2.5–4
M. subclavatum Ga035 37°28′16.4″ N, 130°50′04.5″ E 13.8–24 2.4–5.2 Spindle or irregularly curved Tapered gradually

Table 2

List of primers for PCR and sequencing of nuclear rDNA and chloroplast genes of Monoraphidium

Primer Sequence (5′-3′) Length of the primers (bp) Regions Approx. fragment length (bp)
18F01 CACCTGGTTGATCCTGCCAGTAG 23 18S 1,750
18R1780 GTTCACCTACGGAAACCTTG 20
ITSF-M CCCTCCCACCTAGAGG 17 ITS 840
ITSR-M AGTTGGGCTTTGCGC 15
28F01 CCGCTGAATTTAAGCATATAATTAAG 26 28S 1,200
28R1318 TCGGCAGGTGAGTTGTTACACAC 23
psbBF-M ATGGGATTACCTTGGTA 17 psbB 1,440
psbBR-M GAACTTGTATCACCAAG 17
psbCF-M1 CTGGTAAACTATTAGGTGC 19 psbC 1,240
psbCR-M TCTAAACGGTCAATACCT 18
GrbcLF-M TTAGCTGCATTCCGTATGAC 20 rbcL 1,160
GrbcLR-M CACGACCTTCGTTACGAG 18
tufAF-M ATTCTTTTAGCAAAACAAG 19 tufA 720
tufAR-M GAAGAAGGATTTTTCATTG 19

Table 3

List of sequences utilized for the DNA barcode evaluation of Monoraphidium with GenBank accession numbers

Species Abbreviation Strain GenBank accession No.

18S ITS 28S psbB psbC rbcL tufA
M. contortum Mcnt Ga008 PP711300 PP711300 PP711300 PP734107 PP734155 PP734146 PP734116
M. dybowskii Mdyb Ga011 PP711301 PP711301 PP711301 PP734108 PP734156 PP734147 PP734117
- Ga012 PP766946 PP766946 PP766946 PP935697 PP935676 PP935683 PP935690
M. intermedium Mint Ga016 PP711302 PP711302 PP711302 PP734109 PP734157 PP734148 PP734118
M. komarkovae Mkom Ga022 PP711303 PP711303 PP711303 PP7341010 PP734158 PP734149 PP734119
- Ga013 PP766947 PP766947 PP766947 PP935698 PP935677 PP935684 PP935691
- Ga021 PP766949 PP766949 PP766949 PP935700 PP935679 PP935686 PP935693
M. pusillum Mpus Ga024 PP711304 PP711304 PP711304 PP7341011 PP734159 PP734150 PP734120
- Ga025 PP766950 PP766950 PP766950 PP935701 PP935680 PP935687 PP935694
- Ga032 PP766951 PP766951 PP766951 PP935702 PP935681 PP935688 PP935695
M. minutum Mmin Ga027 PP711305 PP711305 PP711305 PP7341012 PP734160 PP734151 PP734121
M. nanum Mnan Ga031 PP711306 PP711306 PP711306 PP7341013 PP734161 PP734152 PP734122
- C-253 PP766952 PP766952 PP766952 - PP935682 PP935689 PP935696
M. saxatile Msax Ga033 PP711307 PP711307 PP711307 PP7341014 PP734162 PP734153 PP734123
- Ga014 PP766948 PP766948 PP766948 PP935699 PP935678 PP935685 PP935692
M. subclavatum Msub Ga035 PP711308 PP711308 PP711308 PP7341015 PP734163 PP734154 PP734124
Kirchneriella aperta Kape SAG2004 AJ271859 KC145464 KC145445 KT199250 KT199250 KC145514 KT199250

Table 4

A summary of DNA barcode performances of seven markers from Monoraphidium

Markers PCR success first passed species PCR success first pass (%) Putative introns detected Successfully PCR success after troubleshooting (%) Sequence length used for analysis Species resolution (%) (n = 9) Barcoding gap
18S 16/16 100 Yes - 1,728 100 Good
ITS 16/16 100 No - 569 100 Good
28S 16/16 100 Yes - 1,069 100 Intermediate
psbB 9/16 56.3 No 85.7 (6/7) 1,157 100 Good
psbC 9/16 56.3 No 100 (7/7) 736 88.9 Intermediate
rbcL 14/16 87.5 Yes 100 (2/2) 969 100 Good
tufA 15/16 93.8 No 100 (1/1) 688 100 Good