| Home | E-Submission | Sitemap | Contact Us |  
top_img
Algae > Volume 41(1); 2026 > Article
He, Li, Cai, Zeng, Li, Wang, Tan, and Xie: Colaconema zhanjiangensis sp. nov. (Colaconemataceae, Rhodophyta): a new epi-endophytic filamentous red algal species from China

ABSTRACT

The genus Colaconema represents a significant group of filamentous red algae that commonly grow as epiphytes, endophytes, or epi-endophytes on a variety of economically important macroalgae, potentially affecting host health and aquaculture productivity. Although numerous Colaconema species have been described worldwide, few have been reported from China based on integrated morphological and molecular analyses. In this study, Colaconema specimens were collected from the red macroalgae Solieria sp. in Zhanjiang City, Guangdong Province, China, and identified through detailed morphological observations combined with rbcL and 5′ region of cytochrome c oxidase subunit I (COI-5P) sequence analyses. Morphological examination revealed cylindrical cells (23–26 × 6–8 μm), irregularly branched filaments, a single plastid with a single pyrenoid, and ovoid monosporangia (11–12 × 7–9 μm) arranged in various patterns. Molecular analyses demonstrated sufficient sequence divergence from other Colaconema species (rbcL: 5.06–13.65%; COI-5P: 7.23–13.09%), supporting the recognition of these specimens as a new species. The findings expand the current understanding of species diversity within the genus.

INTRODUCTION

The marine red algal genus Colaconema Batters (Colaconemataceae, Rhodophyta) currently comprises 52 species that are widely distributed in tropical and temperate regions (Guiry and Guiry 2025). Colaconema, established by Batters, was originally classified within the order Acrochaetiales Feldmann but was transferred to the newly established order Colaconematales J. T. Harper & G. W. Saunders in 2002 (Harper and Saunders 2002, Hwang and Kim 2011). This reclassification clarified the systematic position of several previously misidentified species. Although members of the Colaconematales generally have more elongated cells than those of the Acrochaetiales, their high morphological similarity continues to complicate species-level identification (Harper and Saunders 2002, Hwang and Kim 2011). Colaconema species are characterized by uniseriate filaments composed of cylindrical cells containing one or more parietal plastids-lobed, laminar, spiral, or irregular, but not stellate, with or without pyrenoids. Monosporangia are usually produced on terminal or intercalary cup-shaped cells, and reproduction is primarily asexual by monospores, with a triphasic life history (Harper and Saunders 2002, Santos and Moura 2010, Hwang and Kim 2011, Lee and Yeh 2021). However, morphological features are often plastic and environmentally influenced, causing difficulty in species delimitation (Garbary 1979, Soares et al. 2020). Consequently, molecular-assisted taxonomy has become essential for distinguishing morphologically similar taxa, particularly using rbcL and 5′ region of cytochrome c oxidase subunit I (COI-5P) gene markers (Araújo et al. 2014, Montoya et al. 2020).
Although Colaconema species have been reported worldwide, studies in China remain limited, with species identification relying primarily on morphological characteristics and relatively few species confirmed using molecular markers. A total of 12 species of Colaconema have been recorded based on taxonomic studies from Mainland China and Taiwan, China. Among these, only C. formosanum M. C. Lee & H. Y. Yeh has been confirmed by molecular analysis (Tseng 2005, Titlyanov et al. 2017, Lee and Yeh 2021, Guiry and Guiry 2025). This gap underscores the need for further molecular studies to accurately resolve species identities and to support the taxonomic framework of the genus. Notably, several of these species are recorded in Audouinella Bory and Acrochaetium Nägeli in Chinese taxonomic literature, reflecting the taxonomic confusion within the group (Tseng 2005, Titlyanov et al. 2017). Such taxonomic uncertainty, coupled with the lack of molecular support for species identifications, limits our understanding of Colaconema diversity and its evolutionary relationships.
Globally, Colaconema species occur as epiphytes, endophytes, or epi-endophytes on macroalgae such as Sargassum C. Agardh, Gelidium J. V. Lamouroux, and Polysiphonia Greville (Hwang and Kim 2011). Solieria J. Agardh (Solieriaceae, Rhodophyta) is an economically important macroalgal genus and one of the major carrageenan-producing taxa, widely used in the food, pharmaceutical, and aquaculture industries (Stephanie et al. 2010, Chopin and Tacon 2021, Burlot et al. 2023). During the cultivation of Solieria sp., an unidentified epi-endophytic red alga was observed proliferating extensively on its thalli, causing necrosis and loss of elasticity. However, no epi-endophytic Colaconema species associated with Solieria have been documented in China to date. In this study, we characterize an epi-endophytic Colaconema species isolated from Solieria sp. in Zhanjiang, Guangdong Province, China, based on detailed morphological observations and molecular analyses of the chloroplast rbcL and mitochondrial COI-5P genes. This finding contributes to the taxonomic and molecular understanding of Colaconema diversity.

MATERIALS AND METHODS

Sampling collections and cultivation

Samples were collected from Donghai Island, Zhanjiang, China (20°56′32″ N, 110°13′23″ E) in August 2023 and transported fresh to the laboratory. The samples were briefly and gently rinsed with sterile seawater to remove loosely attached debris and some surface sediments. The algae were cultured for 21 d in seawater supplemented with Provasoli’s enriched seawater (PES), prepared by adding a 5× PES stock solution at 1 mL L1 and GeO (2 mg L1), under the following conditions: temperature 25°C, salinity 26 ppt, 12:12 h light/dark cycle, and irradiance of 80 μmol photons m2 s1 provided by white LED lamps. Voucher specimens (holotype: MBM288557; isotypes: MBM288558–MBM288560) are deposited at the Marine Biological Specimen Museum, Chinese Academy of Sciences, and preserved as both herbarium sheets and liquid preparations.

Morphological study

For morphoanatomical studies, transverse and longitudinal hand-sections of infected Solieria sp. thalli were prepared using a stainless steel razor blade. Photomicrographs were obtained using an upright fluorescence microscope Leica DM6 B (Leica Microsystems, Wetzlar, Germany) and a Guangzhou Daoyi B60 (Guangzhou Daoyi, Guangzhou, China) equipped with an IC1100 digital camera and DiCamera software. For each anatomical feature, at least 20 sections were examined.

DNA extraction, amplification, and phylogenetic analyses

DNA was extracted from 50–100 mg of fresh red filamentous algae using the Plant Genome Rapid Extraction Kit (Tiangen Biotech, Beijing, China) following the manufacturer’s instructions. An additional chloroform-based phase separation step was performed to remove polysaccharides, proteins, and other contaminants. The quality and concentration of the resulting DNA were evaluated spectrophotometrically.
The large subunit of rbcL was amplified with the primer pairs F57-R1381, F7-R753 and F645-RrbcLstart (Table 1) (Freshwater and Rueness 1994, Lin et al. 2001, Gavio and Fredericq 2002). The mitochondrial COI-5P gene was amplified by polymerase chain reaction (PCR) using the primers GazF1 and GazR1 (Table 1) (Saunders 2005, Montoya et al. 2020). The PCR protocol consisted of an initial denaturation at 94°C for 3 min, followed by 35 cycles conducted under primer-specific conditions: F57-R1381, 30 s at 94°C, 40 s at 49.5°C, and 90 s at 72°C per cycle; F7-R753, 30 s at 94°C, 40 s at 50°C, and 60 s at 72°C per cycle; F645-RrbcLstart, 60 s at 94°C, 60 s at 45°C, and 60 s at 72°C per cycle; GazF1-GazR1, 30 s at 94°C, 40 s at 50°C, and 50 s at 72°C per cycle. All reactions were completed with a final extension at 72°C for 5 min, followed by a soaking step at 4°C. PCR conditions, including primers, annealing temperatures, and extension times, are listed in Table 1. Products were verified by 1% agarose gel electrophoresis and sequenced commercially (BGI, Guangzhou, China). Commercial sequencing is based on the principle of the Sanger method with double deoxy chain end termination. DNA sequences of rbcL and COI-5P genes were obtained from the unknown epi-endophytic alga. All new sequence data generated from this study were deposited in GenBank, with the following accession numbers: PQ461390–PQ461393 (rbcL) and PQ461386–PQ461389 (COI-5P).
For rbcL analysis, we compiled sequence data available from GenBank for 7 Colaconema species and 8 orders belonging to Nemaliophycidae: Palmariales (n = 7), Acrochaetiales (n = 5), Batrachospermales (n = 7), Entwisleiales (n = 2), Nemaliales (n = 6), Ottiales (n = 2), Rhodachlyales (n = 2), and Thoreales (n = 6). For COI-5P analysis, we compiled sequence data available from GenBank for 5 Colaconema species and 4 orders belonging to Palmariales (n = 6), Acrochaetiales (n = 10), Nemaliales (n = 3), and Batrachospermales (n = 1). Phylogenies were inferred and presented as unrooted because no explicit outgroup taxon was designated. The rbcL and COI-5P sequences were subjected to maximum likelihood (ML) and Bayesian inference (BI) phylogenetic analyses. Sequences were aligned using multiple sequence alignment, manually checked, and trimmed using MEGA X (Kumar et al. 2018). The best-fit model of evolution was selected using IQ-TREE2 (Minh et al. 2020) based on the Bayesian information criterion and Akaike information criterion. The best-fit models for rbcL and COI-5P sequences were GTR + F + I + G4 and TIM2 + F + I + G4, respectively. ML phylogenetic analysis was performed in IQ-TREE, with statistical support assessed using 1,000 bootstrap replicates. The BI was conducted with MrBayes v3.2.7 (Ronquist et al. 2012) applying the GTR + F + I + G4 model for both markers, as TIM2 is not implemented in MrBayes. Two independent runs of four Markov Chain Monte Carlo chains were performed, with trees sampled every 100 generations for a total of 1,000,000 generations. The first 25% of the sampled trees were discarded as burn-in, and the remaining trees were used to calculate the Bayesian posterior probability for each clade. ML and BI trees were visualized and edited in FigTree v1.4.4 software (Rambaut 2018). Genetic distances between sequences were calculated using the Kimura 2-parameter model in MEGA X.

RESULTS

New species morphological observation

Colaconema zhanjiangensis H. Q. Tan & H. P. He sp. nov

Description

Thallus epi-endophytic on Solieria sp. and artificial substrata (culture ropes), caespitose, composed of basal and erect filaments, up to 5 mm high, bright red color. Basal filaments are endophytic, creeping along the host surface and growing downward between the epidermal cells of the host. Cells of endophytic filaments are slightly contorted cylindrical or irregular polygonal. Erect filaments arise at right angles from basal prostrate filaments, tapering toward apices. Cells of erect filaments are cylindrical and either not constricted or slightly constricted at the septum, 23–26 μm long and 6–8 μm in diameter, containing a single pyrenoid and one parietal or lobed plastid. Monosporangia are mostly distributed at the base of lateral branches, either sessile or borne on 1–4 cells, with a few forming short clusters. They are ovoid to ellipsoid, 11–12 μm long and 7–9 μm in diameter. No tetrasporangia or gametangia were observed.

Holotype

MBM288557 collected by H. Q. Tan & H. P. He, epi-endophytic on the red alga Solieria sp., deposited at the Marine Biological Specimen Museum, Chinese Academy of Sciences (MBMCAS), China, GenBank accession: PQ461390 (rbcL), PQ461386 (COI-5P).

Isotypes

MBM288558–MBM288560, collected by H. Q. Tan & H. P. He. Voucher specimens have been deposited at the MBMCAS, China. GenBank accession: PQ461391–PQ461393 (rbcL), PQ461387-PQ461389 (COI-5P).

Type locality

Donghai Island zone, Zhanjiang, Guangdong Province, China (20°56′32″ N, 110°13′23″ E).

Distribution

Only known from type locality at present.

Habitat

Intertidal, epi-endophytic on Solieria sp. and on artificial substrata (culture ropes).

Chinese name

湛江寄丝藻 (Zhanjiang Jisizao).

Etymology

The specific epithet refers to the collection locality, Zhanjiang.

Vegetative structure

The thallus is epi-endophytic on Solieria sp. (Fig. 1 A), bright red color, caespitose, composed of basal discs and erect filaments (Fig. 1 B & C). Erect filaments arise from small basal discs (Fig. 1 C & D). Upon attachment, it can grow to about 5 mm, whereas under isolated culture conditions, it can reach up to 2.5 cm. Endophytic cells invade the cortical and subcortical cells of the host (Fig. 1 D & E). Cells of the erect filaments are cylindrical, not constricted at the septum, while endophytic cells are irregular in shape (Fig. 1 E). Cells with a single pyrenoid, and single parietal or lobed plastids (Fig. 1 F). Branching of erect axes is irregular, with secondary or alternate branches arising at various intervals (Fig. 1 B). Lateral branches typically emerge from the sides of cells along the main axis, forming distinct branches; multiple lateral branches may occasionally arise from a single cell. Lateral branches are generally shorter than the main axes and do not form pseudo-hairs (Fig. 1 B). Cells at the lower base measure 6–10 μm in width and 16–28 μm in length. Cells of erect filaments are 6–8 μm wide and 23–26 μm long, while lateral branch cells are smaller, measuring 5–8 μm in width and 12–22 μm in length. Cells toward the apices are smaller and appear to bear transparent hairs, which are artifacts of the apical cell shape (Fig. 1 J). The length-to-diameter (L:D) ratios of cells at the lower base, mid-branch, and lateral branches are 3.4:1, 3.6:1, and 2.7:1, respectively.

Reproductive morphology

The monosporangia are ovoid to ellipsoid and are typically distributed along the main axis and on the lateral branches, occurring singly, in pairs, or in clusters, either sessile or borne on 1–4 celled pedicels (Fig. 1 G–I), and measure 11–12 μm in length and 7–9 μm in diameter. After spore release, the empty wall of the monosporangium remains attached (Fig. 1 G). The released monospores germinate unipolarly, developing into tubular cells that gradually elongate and exhibit transparent spherical vacuoles and filamentous structures (Fig. 1 K). Filament elongation and branching result in the formation of creeping branches, which subsequently produce erect branches (Fig. 1 L).

The phylogenetic tree analysis of Colaconema species

The rbcL and COI-5P sequences were subjected to ML and BI phylogenetic analyses. A total of 49 rbcL sequences were analyzed, including four newly generated sequences (PQ461390–PQ461393; 1,198 bp), and 34 COI-5P sequences were included, among which four were newly generated in this study (PQ461386–PQ461389; 583 bp). Phylogenetic trees were reconstructed using ML and BI, showing that the unknown specimens’ rbcL and COI-5P sequences nested within Colaconematales, forming a monophyletic clade with distinct affiliations. Because the ML and BI topologies were nearly identical, the ML consensus tree is presented, with BI posterior probabilities mapped onto the corresponding nodes.
In the rbcL phylogeny (Fig. 2), C. zhanjiangensis formed a sister relationship with C. formosanum (MW182307 and MW182308), with strong support (ML = 86%, BI = 1.00). The genetic distance between the two species was 5.06–5.15% (Supplementary Table S1). In the COI-5P phylogeny (Fig. 3), C. zhanjiangensis was also sister to two specimens of C. formosanum (MW182304 and MW182305), again with strong support (ML = 94%, BI = 1.00). The genetic distance between them was 7.23% (Supplementary Table S2). Collectively, the molecular evidence strongly supports the taxonomic placement of this filamentous red algal species from Zhanjiang. We therefore designate it as a new species, Colaconema zhanjiangensis sp. nov.

DISCUSSION

In the present study, C. zhanjiangensis exhibited typical characteristics of the genus, including cylindrical cells, irregularly branched filaments, monosporangia, a single parietal chloroplast, and a single pyrenoid. The species displayed a Type II germination pattern, in which the protoplast remains within the spore during germ tube development (Harper and Saunders 2002). This pattern is consistent with C. daviesii (Dillwyn) Stegenga and C. formosanum and is considered a supplementary diagnostic character for the genus (Montoya et al. 2020, Lee and Yeh 2021). However, data regarding such a character remain scarce across known species, highlighting the need for further research to understand its biological significance.
A total of 12 Colaconema species have been documented from mainland China and Taiwan, China, and a detailed comparison of their morphology, together with that of related Asian taxa, is provided in Table 2 (Tseng 2005, Hwang and Kim 2011, Titlyanov et al. 2017, Lee and Yeh 2021, Guiry and Guiry 2025). C. zhanjiangensis can be readily distinguished from its congeners by a unique combination of morphological characters, including relatively long thalli (up to 5 mm), the presence of a basal disc, medium-sized cylindrical vegetative cells (6–8 μm in diameter and 23–26 μm in length) with a single pyrenoid, and medium-sized ovoid to ellipsoid monosporangia that occur singly, in pairs, or in clusters, either sessile or borne on 1–4-celled pedicels. This suite of characters clearly separates the species from all previously described taxa. C. bonnemaisoniae Batters, C. emergens (Rosenvinge) R. Nielsen, C. nakamurae Woelkerling, and C. robustum (Børgesen) Huisman & Woelkerling differ from C. zhanjiangensis in basal structures, such as having entirely prostrate filaments or a single basal cell, as well as in monosporangial arrangement. C. codicola (Børgesen) Stegenga, J. J. Bolton & R. J. Anderson is characterized by 2–5 pyrenoids per cell and relatively large vegetative cells, in contrast to C. zhanjiangensis, which has a single pyrenoid and medium-sized cells. Similarly, the vegetative cells of C. daviesii, C. dictyotae (Collins) I. K. Hwang & H. S. Kim, and C. thuretii (Bornet) P. W. Gabrielson are considerably larger than those of C. zhanjiangensis. C. codii (Hamel) I. K. Hwang & H. S. Kim has notably larger monosporangia than C. zhanjiangensis, but its vegetative cells are distinctly shorter. Regarding thallus height, C. zhanjiangensis is of medium stature, whereas species such as C. attenuatum (Rosenvinge) R. Nielsen, C. comptum (Børgesen) I. K. Hwang & H. S. Kim, and C. hyalosiphoniae (Nakamura) I. K. Hwang & H. S. Kim have relatively short thalli (≤1.5 mm), and C. formosanum is much taller, reaching 2.0–2.8 cm. The ovoid to ellipsoid monosporangia of C. zhanjiangensis also differ from the subspherical monosporangia of C. formosanum. Overall, the combination of thallus length, basal disc, thallus height, cell and monosporangia size, single pyrenoid, and monosporangial arrangement provides a clear and reliable basis for distinguishing C. zhanjiangensis from all other known Colaconema species.
Although the characteristics mentioned are sufficient to distinguish C. zhanjiangensis as a new species, morphological characters, while distinguishing, are often subjective and prone to variable interpretation. Additionally, environmental factors influence algal morphology, further complicating their use in taxonomic evaluation (Freshwater et al. 2022). In contrast, molecular markers have been widely adopted in species identification due to their greater stability and reliability. Among these, the mitochondrial-encoded cox1 gene and the plastid-encoded rbcL gene have been proposed as potential barcodes for rhodophytes (Tan et al. 2012). Consequently, molecular phylogenetics provides a more reliable approach for taxonomy within Nemaliophycidae, with molecular-assisted identification using plastid-encoded rbcL and COI-5P playing a significant role in distinguishing species within Colaconema (Lee and Yeh 2021).
In the rbcL and COI-5P genes analysis, the genetic sequence divergence between C. zhanjiangensis and C. formosanum is 5.06–5.15% and 7.23%, respectively. The genetic distance between C. zhanjiangensis and other species within the Colaconema genus shows that the rbcL gene has a genetic distance ranging from 7.73 to 13.65%, and the COI-5P gene has a genetic distance ranging from 9.80 to 13.09%. There are a few molecular classification reports on Colaconema, but other related studies can provide some reference value. For example, the pairwise genetic distances among related species in the phylogenetic analyses for rbcL were 4.65% between A. secundatum and A. plumosum, and 4.39% between Rhodophysema elegans and R. georgei (Supplementary Table S1). For COI-5P, the distances were 5.54% between A. moniliforme and A. catenulatum, and 6.56% between A. moniliforme and A. densum (Supplementary Table S2). Additionally, it has been reported that the rbcL genetic distance among different Gracilaria species ranges from 3.13 to 9.5% (Wang et al. 2023), while the COI-5P genetic distance among Gelidium species ranges from 2.7 to 5.4% (Boo and Kim 2020). Although these thresholds cannot be directly applied to Colaconema, the relatively conserved evolutionary rates of rbcL and COI-5P across Rhodophyta make them meaningful reference points for assessing species boundaries. Overall, the genetic divergences observed between C. zhanjiangensis and C. formosanum provide sufficient evidence to support the recognition of C. zhanjiangensis as a distinct new species.
Species within the Colaconema genus have potential commercial value. C. formosanum is rich in phycoerythrin, whose purified products exhibit good light stability in the development of UV protection cosmetics, providing an important reference for the development of the newly discovered species in this study (Lee et al. 2021b, Yeh et al. 2022, 2023). Additionally, R-phycoerythrin from Colaconema sp. can modulate the immune response of white leg shrimp, both in vitro and in vivo, indicating its potential as an immunomodulator (Lee et al. 2021a). The protein hydrolysates extracted from C. formosanum exhibited significant antioxidant activity, and the angiotensin-converting enzyme inhibitory peptides from the same species may serve as potential candidates for the development of functional foods for hypertension management (Windarto et al. 2024a, 2024b). Despite limited research on Colaconema species, these findings indicate their potential applications in cosmetics, functional foods, and immunology.
In Solieria sp., infestation led to the formation of dense filamentous masses that enveloped the host thalli. As the infestation progressed, filament proliferation caused tissue softening, fragmentation, and structural collapse. Histological observations confirmed that the filaments had penetrated beyond the epidermis into deeper tissues. These symptoms are consistent with previously reported Colaconema infestations (Vairappan et al. 2008, Araújo et al. 2014, Montoya et al. 2024). Studies have shown that in K. alvarezii infected with Colaconema species, distinct morphological and cellular alterations occur, including disruption of chloroplast structure, reduction of grains, and noticeable thickening of the cell walls (Araújo et al. 2014). The symptoms and cellular damage collectively suggest that Colaconema infestations can lead to host mortality and compromise cultivation. As such, these Colaconema species pose a potential risk to the macroalgal aquaculture industry (Ward et al. 2020, Behera et al. 2022, Montoya et al. 2024).
C. zhanjiangensis, the first Colaconema species reported to infect Solieria in China, is distinguished by distinct morphological characteristics and supported by molecular phylogenetic evidence. Its observed impacts on host health suggest potential risks to macroalgal aquaculture, highlighting the need for ongoing monitoring and additional studies on host specificity, infestation mechanisms, and ecological consequences.
This study reports the first Colaconema species infecting Solieria in China. Both morphological and molecular evidence support its recognition as a new species, Colaconema zhanjiangensis sp. nov. We recommend that future studies employ metabolomics approaches to investigate changes in secondary metabolites during host-parasite interactions, which may help elucidate parasitic mechanisms and provide insights relevant to potential biocontrol strategies. Furthermore, we encourage researchers to deposit molecular data of other Colaconema species in public databases, which would facilitate more accurate and comprehensive classification and promote global collaboration in the systematics of this genus.

Notes

ACKNOWLEDGEMENTS

This research was supported by the Industrial Cultivation and Demonstration of New Large Marine Algae Species in the Western Guangdong Marine Ranching China (2024-MR I-001-06), the Core Technology Research Project for Suitable Species of Modern Marine Ranching in Guangdong Province China (2024-MRB-00-001) and the Southern Marine Science and Engineering Guangdong Laboratory (Zhanjiang), China (ZJW-2024-15).

CONFLICTS OF INTEREST

The authors declare that they have no potential conflicts of interest.

SUPPLEMENTARY MATERIALS

Supplementary Table S1. Pairwise genetic distances based on rbcL sequences among related species included in this study (https://www.e-algae.org).
algae-2026-41-2-26-Supplementary-Table-S1.xls
Supplementary Table S2. Pairwise genetic distances based on COI-5P sequences among related species included in this study (https://www.e-algae.org).
algae-2026-41-2-26-Supplementary-Table-S2.xls

Fig. 1
Morphology of Colaconema zhanjiangensis sp. nov. (A) Thallus epi-endophytic on Solieria sp. (B) Branching of erect axes irregular, primarily secund, with the lateral branches typically being shorter (arrow). (C) The erect filaments (arrowhead) epiphytically grow on the surface, forming a basal disc (arrow). (D) Longitudinal section of the basal disc, a single layer of cells (arrow), erect filaments (arrowhead). (E) Endophytic filaments invade the cortical and subcortical cells (arrow). (F) Detail of erect filaments showing cells with one pyrenoid (arrow). (G) Empty shells (arrow). (H) Sporangia with pedicels and sporangium branches, the arrow indicates a monosporangium. (I) Mature monosporangia. (J) Tapering slightly toward apices (arrow). (K) A tube-like cell emerged from the spore, gradually expanded and branched. (L) Tube-like cell branches and gives rise to erect filaments (arrow). Scale bars represent: A, 5 mm; B, 100 μm; C–E & J, 30 μm; F–H, K & L, 20 μm; I, 10 μm.
algae-2026-41-2-26f1.jpg
Fig. 2
Maximum likelihood (ML) topology based on rbcL DNA sequences. ML bootstrap support values are shown to the left of each node, andBayesian posterior probabilities to the right. Sequences generated in this study are shown in bold; otherwise, they are from GenBank.
algae-2026-41-2-26f2.jpg
Fig. 3
Maximum likelihood (ML) topology based on 5′ region of cytochrome c oxidase subunit I (COI-5P) DNA sequences. ML bootstrap supportvalues are shown to the left of each node, and Bayesian posterior probabilities to the right. Sequences generated in this study are shown in bold; otherwise, they are from GenBank.
algae-2026-41-2-26f3.jpg
Table 1
Polymerase chain reaction (PCR) primer sequences
Primer name Primers sequence for the PCR (5′→3′) Annealing temperature (°C) Extension time (s) References
F57-R1381 F: GTAATTCCATATGCTAAAATGGG
R: ATCTTTCCATAGATCTAAAGC
49.5 90 Freshwater and Rueness (1994)
F7-R753 F: AACTCTGTAGAACGNACAAG
R: GCTCTTTCATACATATCTTCC
50 60 Freshwater and Rueness (1994), Gavio and Fredericq (2002)
F645-RrbcLstart F: ATGCGTTGGAAAGAAAGATTCT
R: TGTGTTGTCGACATGTCTAACTCTGTAGAAG
45 60 Freshwater and Rueness (1994), Lin et al. (2001)
GazF1-GazR1 F: TCAACAAATCATAAAGATATTGG
R: ACTTCTGGATGTCCAAAAAAYCA
50 50 Saunders (2005), Montoya et al. (2020)
Table 2
Comparison of diagnostic characteristics between Colaconema zhanjiangensis sp. nov. and other similar Colaconema species distributed across Asia and Southeast Asia
Species Habit Basal part Thallus long Cell size (μm) Pyrenoid Monosporangia shape Monosporangia size (μm) Monosporangia arrangement Distribution References
Colaconema zhanjiangensis Intertidal Disc Up to 5 mm 23–26 × 6–8 1 Ovoid to ellipsoid 11–12 × 7–9 Arranged singly, in pairs, or in clusters, either sessile or on 1–4 celled laterals, with a few forming short clusters Mainland, China This study
Colaconema attenuatum Intertidal Disc 0.3–0.4 mm 10–15 (−19) × 7–8 1 Ovoid 9–12 × 9–10 Apical or lateral, mostly on upper filaments; monosporangia occasionally in pairs, sessile, rarely stalked with a single-cell stalk Mainland, China Tseng (2005)
Colaconema bonnemaisoniae Intertidal Entirely prostrate filaments - - 1 Ovoid 12–20 × 12–13 Stalkless, solitary on short filamentous cells Mainland, China Tseng (2005)
Colaconema codii Intertidal - - 8.7–11 × 6.7–8 - 17–20 × 11–13 Lateral, solitary or clustered, stalked or sessile, stalk 1–2 cells Mainland, China Tseng (2005)
Colaconema codicola Intertidal - 0.5–1 cm 50–75 × 15–25 2–5 Ovoid, ellipsoid, or elongate-ovoid 25–40 × 15–22 Typically arising on the inner surfaces of branches; predominantly stalked, occasionally sessile, with a single stalk cell Mainland, China Tseng (2005)
Colaconema comptum - - 1.0–1.2 mm 15–20 × 6–8 1 Oblong to ellipsoid 12–14 × 6–8 On adaxial side of laterals or rarely clustered on 2–3 celled short laterals, solitary on single- or rarely two-celled stalks Korea Hwang and Kim (2011)
Colaconema daviesii - Disc 0.7–1.3 (4) mm 7–8 (−11) in diameter, 1.5–4 (−5.5) diameter long 1 Ovoid 14–20 × 8–12 Develop at the base of branches or terminally on short 1–5 celled lateral (adaxial) branchlets Mainland, China Titlyanov et al. (2017)
Colaconema dictyotae Intertidal Disc 1.5–2 mm 15–40 × 8–12 1 Ovoid to ellipsoid 10–12.5 × 8–10 Solitary or clustered in 2–5, sometimes several consecutively lateral; stalked or sessile, stalk 1–2 cells Mainland, China Tseng (2005)
Colaconema hyalosiphoniae - Disc 1–1.5 mm 14–27 × 10–14 1 Oblong 10–15 × 8–10 Produced secundly on short branchlets Korea Hwang and Kim (2011)
Colaconema emergens Intertidal or subtidal Entirely prostrate filaments - 6.5–12.5 × 2.5–7.3 - Ovoid to subspherical 3–7.5 × 3–7.5 Stalkless, solitary or several consecutively borne on the lateral sides of branches Mainland, China Tseng (2005)
Colaconema formosanum - Disc 2.0–2.8 cm 12.5–15 × 6.0–7.5 1 Subspherical 12–13 × 9.5–10 Observed only on the apical cells of the lateral branch, solitary or in clusters Taiwan, China Lee and Yeh (2021)
Colaconema graeilis Intertidal - 0.7–1 mm 12–20 × 4.5–7 1 Ovoid 10–13 × 7.5–8 Sessile, or pedicellate (1–2-celled stalk) Mainland, China Tseng (2005)
Colaconema hypneae - Disc 0.45–1 mm 16–22.5 (−30) × 6–7.5 (−11) 1 Ovoid 10–12.5–15 × 5–7 (−9) Sessile, or pedicellate (1–2-celled stalk), borne adaxially seriate, from each cell Mainland, China Titlyanov et al. (2017)
Colaconema nakamurae Intertidal Single basal cell 75–175 μm 6–9 × 5–7 - Ovoid 7–10 × 5–8 Mostly solitary and consecutively lateral, occasionally apical, rarely with a single stalk cell Mainland, China Tseng (2005)
Colaconema thuretii - Disc Up to 5 mm 30–50 × 10–11 1 Ellipsoid 19–22 × 11–13 Solitary or in pairs on single-celled stalks, on adaxial side of the lower region of branches or on short laterals Korea Hwang and Kim (2011)
Colaconema robustum - Single basal cell (0.3−) 1.0–2.0 (−3) mm 15–22.5–26.5 (−32) × 8–10 (−12) 1 Oval, oblong 17.5–19 (−22) × 6–9 (−114) Arranged unilaterally, adaxially seriate (in series of 4–5 cells), or alternately, on 1–2-celled stalk or sessile Mainland, China Titlyanov et al. (2017)

– indicates that the morphological feature has not been reported in the existing literature.

REFERENCES

Araújo, P. G., Schmidt, ÉC, Kreusch, M. G., et al. 2014. Ultrastructural, morphological, and molecular characterization of Colaconema infestans (Colaconematales, Rhodophyta) and its host Kappaphycus alvarezii (Gigartinales, Rhodophyta) cultivated in the Brazilian tropical region. J. Appl. Phycol. 26:1953–1961. doi.org/10.1007/s10811-014-0348-9
crossref pdf
Behera, D. P., Ingle, K. N., Mathew, D. E., et al. 2022. Epiphytism, diseases and grazing in seaweed aquaculture: a comprehensive review. Rev. Aquac. 14:1345–1370. doi.org/10.1111/raq.12653
crossref pdf
Boo, G. H. & Kim, K. M. 2020. A new species of marine algae from Korea based on morphology and molecular data: Gelidium palmatum sp. nov. (Gelidiales, Rhodophyta). Algae. 35:33–43. doi.org/10.4490/algae.2020.35.3.6
crossref pdf
Burlot, A.-S., Freile-Pelegrín, Y., Bourgougnon, N., et al. 2023. Concise review of the genus Solieria J. Agardh, 1842. J. Appl. Phycol. 35:961–982. doi.org/10.1007/s10811-023-02934-z
crossref pdf
Chopin, T. & Tacon, A. G. J. 2021. Importance of seaweeds and extractive species in global aquaculture production. Rev. Fish. Sci. Aquac. 29:139–148. doi.org/10.1080/23308249.2020.1810626
crossref
Freshwater, D. W. & Rueness, J. 1994. Phylogenetic relationships of some European Gelidium (Gelidiales, Rhodophyta) species, based on rbcL nucleotide sequence analysis. Phycologia. 33:187–194. doi.org/10.2216/i0031-8884-33-3-187.1
crossref
Freshwater, D. W., Williamson, B., Gabrielson, P. W. & Brandt, M. 2022. Gracilaria parva sp. nov. (Gracilariales, Rhodophyta) a diminutive species from the tropical eastern Pacific. Taxonomy. 2:48–56. doi.org/10.3390/taxonomy2010004
crossref
Garbary, D. 1979. The effects of temperature on the growth and morphology of some Audouinella spp. (Acrochaetiaceae, Rhodophyta). Bot. Mar. 22:493–498. doi.org/10.1515/botm.1979.22.8.493
crossref
Gavio, B. & Fredericq, S. 2002. Grateloupia turuturu (Halymeniaceae, Rhodophyta) is the correct name of the non-native species in the Atlantic known as Grateloupia doryphora. Eur. J. Phycol. 37:349–359. doi.org/10.1017/S0967026202003839
crossref
Guiry, M. D. & Guiry, G. M. 2025. AlgaeBase. World-wide electronic publication, National University of Ireland, Galway, Available from: https://www.algaebase.org. Accessed Mar 6, 2025

Harper, J. T. & Saunders, G. W. 2002. A re-classification of the Acrochaetiales based on molecular and morphological data, and establishment of the Colaconematales ord. nov. (Florideophyceae, Rhodophyta). Eur. J. Phycol. 37:463–476. doi.org/10.1017/S0967026202003840
crossref
Hwang, I. K. & Kim, H. S. 2011. Nemaliophycidae: Colaconematales: Colaconemataceae. In Hwang, I. K. & Kim, H. S. (Eds.) Algal Flora of Korea. National Institute of Biological Resources, Incheon, pp. 44–67.

Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. 2018. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35:1547–1549. doi.org/10.1093/molbev/msy096
crossref pmid pmc
Lee, M.-C. & Yeh, H.-Y. 2021. Molecular and morphological characterization of Colaconema formosanum sp. nov. (Colaconemataceae, Rhodophyta): a new endophytic filamentous red algal species from Taiwan. J. Mar. Sci. Eng. 9:809. doi.org/10.3390/jmse9080809
crossref
Lee, P.-T., Huang, J., Huang, C.-Y., et al. 2021a. Phycoerythrin from Colaconema sp. has immunostimulatory effects on the whiteleg shrimp Litopenaeus vannamei and increases resistance to Vibrio parahaemolyticus and white spot syndrome virus. Animals. 11:2371. doi.org/10.3390/ani11082371
crossref pmid pmc
Lee, P.-T., Yeh, H.-Y., Lung, W-Q-C, et al. 2021b. R-phycoerythrin from Colaconema formosanum (Rhodophyta), an anti-allergic and collagen promoting material for cosmeceuticals. Appl. Sci. 11:9425. doi.org/10.3390/app11209425
crossref
Lin, S.-M., Fredericq, S. & Hommersand, M. H. 2001. Systematics of the Delesseriaceae (Ceramiales, Rhodophyta) based on large subunit rDNA and rbcL sequences, including the Phycodryoideae, subfam. nov. J. Phycol. 37:881–899. doi.org/10.1046/j.1529-8817.2001.01012.x
crossref
Minh, B. Q., Schmidt, H. A., Chernomor, O., et al. 2020. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 37:1530–1534. doi.org/10.1093/molbev/msaa015
crossref pmid pmc pdf
Montoya, V., Alvear, P. & Bulboa, C. 2024. Infestation by Colaconema daviesii (Rhodophyta, Colaconematales) of haploid and diploid thalli of edible red seaweed Chondracanthus chamissoi (Rhodophyta, Gigartinales): effects on growth and survival. J. Appl. Phycol. 36:2039–2051. doi.org/10.1007/s10811-024-03215-z
crossref pdf
Montoya, V., Meynard, A., Contreras-Porcia, L. & Contador, C. B. 2020. Molecular identification, growth, and reproduction of Colaconema daviesii (Rhodophyta; Colaconematales) endophyte of the edible red seaweed Chondracanthus chamissoi. J. Appl. Phycol. 32:3533–3542. doi.org/10.1007/s10811-020-02176-3
crossref pdf
Rambaut, A. 2018. FigTree v1.4.4, Institute of Evolutionary Biology, University of Edinburgh, Available from: https://github.com/rambaut/figtree/releases/tag/v1.4.4. Accessed Mar 27, 2025

Ronquist, F., Teslenko, M., Van Der Mark, P., et al. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61:539–542. doi.org/10.1093/sysbio/sys029
crossref pmid pmc
Santos, A. A. D. & Moura, C. W. D. N.n 2010. New combination in Colaconema (Colaconematales, Rhodophyta), addition to marine algae from Northeastern of Brazil. Rodriguésia. 61:S73–S77. doi.org/10.1590/2175-7860201061136
crossref
Saunders, G. W. 2005. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360:1879–1888. doi.org/10.1098/rstb.2005.1719
crossref pmid pmc pdf
Soares, L. P., de Beauclair Guimarães, S. M. P., Fujii, M. T., et al. 2020. Rhodachlya westii sp. nov. (Rhodachlyales, Rhodophyta), a new species from Brazil, revealed by an integrative taxonomic approach. Phycologia. 59:346–354. doi.org/10.1080/00318884.2020.1763771
crossref
Stephanie, B., Eric, D., Sophie, F. M., Christian, B. & Yu, G. 2010. Carrageenan from Solieria chordalis (Gigartinales): structural analysis and immunological activities of the low molecular weight fractions. Carbohydr. Polym. 81:448–460. doi.org/10.1016/j.carbpol.2010.02.046
crossref
Tan, J., Lim, P.-E., Phang, S.-M., Hong, D. D., Sunarpi, H. & Hurtado, A. Q. 2012. Assessment of four molecular markers as potential DNA barcodes for red algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta). PLoS ONE. 7:e52905. doi.org/10.1371/journal.pone.0052905
crossref pmid pmc
Titlyanov, E. A., Titlyanova, T. V., Li, X. & Huang, H. 2017. Chapter 4 - Common marine algae of Hainan Island (Guidebook). In Titlyanov, E. A., Titlyanova, T. V., Li, X., & Huang, H. (Eds.) Coral Reef Marine Plants of Hainan Island. Academic Press, New York, pp. 75–228.

Tseng, C. K. 2005. Acrochaetiales. In Tseng, C. K. (Ed.) Flora Algarum Marinarum Sinicarum. Science Press, Beijing, pp. 13–42.

Vairappan, C. S., Chung, C. S., Hurtado, A. Q., Soya, F. E., Lhonneur, G. B. & Critchley, A. 2008. Distribution and symptoms of epiphyte infection in major carrageenophyte-producing farms. J. Appl. Phycol. 20:477–483. doi.org/10.1007/s10811-007-9299-8
crossref pdf
Wang, X., Guo, M., Yan, S., et al. 2023. Diversity of Gracilariaceae (Rhodophyta) in China: an integrative morphological and molecular assessment including a description of Gracilaria tsengii sp. nov. Algal Res. 71:103074. doi.org/10.1016/j.algal.2023.103074
crossref
Ward, G. M., Faisan, J. P. Jr., Cottier-Cook, E. J., et al. 2020. A review of reported seaweed diseases and pests in aquaculture in Asia. J. World Aquac. Soc. 51:815–828. doi.org/10.1111/jwas.12649
crossref pdf
Windarto, S., Hsu, J.-L. & Lee, M.-C. 2024a. First report of antioxidant potential of peptide fraction derived from Colaconema formosanum (Rhodophyta) protein hydrolysates. Biocatal. Agric. Biotechnol. 58:103232. doi.org/10.1016/j.bcab.2024.103232
crossref
Windarto, S., Lee, M.-C., Nursyam, H. & Hsu, J.-L. 2024b. A novel phycoerythrin-derived peptide from Colaconema formosanum: synthesis, in vitro, and in silico study on angiotensin-converting enzyme (ACE) inhibitory activity. Biocatal. Agric. Biotechnol. 62:103452. doi.org/10.1016/j.bcab.2024.103452
crossref
Yeh, H.-Y., Wang, W.-L., Lin, Y.-K., Nan, F.-H. & Lee, M.-C. 2023. Optimizing inorganic carbon and salinity for enhanced biomass and pigment production in Colaconema formosanum: implications for sustainable carbon sequestration and stress responses. Bioresour. Technol. 388:129720. doi.org/10.1016/j.biortech.2023.129720
crossref pmid
Yeh, H.-Y., Wang, W.-L., Nan, F.-H. & Lee, M.-C. 2022. Enhanced Colaconema formosanum biomass and phycoerythrin yield after manipulating inorganic carbon, irradiance, and photoperiod. Bioresour. Technol. 352:127073. doi.org/10.1016/j.biortech.2022.127073
crossref pmid
Editorial Office
[14348] A-1716, Gwangmyeong Trade Center, 72 Iljik-ro Gwangmyeong-si. Gyeonggi-do, Korea
Tel: +82-2-899-5980  Fax: +82-2-899-5922    E-mail: editalgae@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © The Korean Society of Phycology.                 Developed in M2PI